FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633841_at:

>probe:Drosophila_2:1633841_at:250:161; Interrogation_Position=1002; Antisense; ACAAGGATTCCTGTTCTGTGGCTTC
>probe:Drosophila_2:1633841_at:310:249; Interrogation_Position=1034; Antisense; CAATCGGAATTTTCGGCTGGGACAT
>probe:Drosophila_2:1633841_at:529:369; Interrogation_Position=1061; Antisense; GAAGGCCCTACAATCGCGAAAATGT
>probe:Drosophila_2:1633841_at:287:665; Interrogation_Position=1091; Antisense; TACTTGCTATTAATCCGGCTACGCT
>probe:Drosophila_2:1633841_at:433:631; Interrogation_Position=1104; Antisense; TCCGGCTACGCTGCAATTTGTGAGT
>probe:Drosophila_2:1633841_at:424:583; Interrogation_Position=1128; Antisense; TGGCATGAAGATTGTCCGCAGACCT
>probe:Drosophila_2:1633841_at:584:337; Interrogation_Position=1179; Antisense; GCTCTCCGATCGACTGCAGAAGATA
>probe:Drosophila_2:1633841_at:594:9; Interrogation_Position=1203; Antisense; ATTCGCCGGAACCATTGACTACAGG
>probe:Drosophila_2:1633841_at:352:419; Interrogation_Position=702; Antisense; GAGCTCCTGGCGCATCGAGAACAAA
>probe:Drosophila_2:1633841_at:170:387; Interrogation_Position=720; Antisense; GAACAAATTCACCTATCCGGATGCT
>probe:Drosophila_2:1633841_at:563:65; Interrogation_Position=791; Antisense; ATGGACCTTTGGCTTTGGCGACGAC
>probe:Drosophila_2:1633841_at:559:553; Interrogation_Position=873; Antisense; GGAGCTGGCCATTCCTTTGGATATC
>probe:Drosophila_2:1633841_at:650:285; Interrogation_Position=940; Antisense; CTGTCGGAATTCACTGTCTTGGGTA
>probe:Drosophila_2:1633841_at:580:81; Interrogation_Position=969; Antisense; AGGGATTCAGTGTGCCTCGCATGCG

Paste this into a BLAST search page for me
ACAAGGATTCCTGTTCTGTGGCTTCCAATCGGAATTTTCGGCTGGGACATGAAGGCCCTACAATCGCGAAAATGTTACTTGCTATTAATCCGGCTACGCTTCCGGCTACGCTGCAATTTGTGAGTTGGCATGAAGATTGTCCGCAGACCTGCTCTCCGATCGACTGCAGAAGATAATTCGCCGGAACCATTGACTACAGGGAGCTCCTGGCGCATCGAGAACAAAGAACAAATTCACCTATCCGGATGCTATGGACCTTTGGCTTTGGCGACGACGGAGCTGGCCATTCCTTTGGATATCCTGTCGGAATTCACTGTCTTGGGTAAGGGATTCAGTGTGCCTCGCATGCG

Full Affymetrix probeset data:

Annotations for 1633841_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720