Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633842_at:

>probe:Drosophila_2:1633842_at:228:353; Interrogation_Position=1402; Antisense; GCAGCAGTCTTAGCCAGCGCAGGAC
>probe:Drosophila_2:1633842_at:229:351; Interrogation_Position=1510; Antisense; GCAGCAGTTCCTCCATTGGTGGCTA
>probe:Drosophila_2:1633842_at:86:189; Interrogation_Position=1591; Antisense; AACAGCAGCAAAAGCGCCGTCGCCA
>probe:Drosophila_2:1633842_at:508:209; Interrogation_Position=1677; Antisense; AAGAATCGTCAATTCTACGGCGACG
>probe:Drosophila_2:1633842_at:131:187; Interrogation_Position=1728; Antisense; AACAAGGATCCAGTGACGACCACCA
>probe:Drosophila_2:1633842_at:604:327; Interrogation_Position=1760; Antisense; GCGTCCCTTCTGGAATATCCTGGGT
>probe:Drosophila_2:1633842_at:633:241; Interrogation_Position=1773; Antisense; AATATCCTGGGTCGCCAATCGGATT
>probe:Drosophila_2:1633842_at:581:39; Interrogation_Position=1790; Antisense; ATCGGATTCGAAGCCCAGTGCGGAA
>probe:Drosophila_2:1633842_at:478:627; Interrogation_Position=1815; Antisense; TCCACTGTTGTCTCTTCCGAAGAAT
>probe:Drosophila_2:1633842_at:566:375; Interrogation_Position=1833; Antisense; GAAGAATCCCAAACGGATCCCGTCG
>probe:Drosophila_2:1633842_at:373:113; Interrogation_Position=1861; Antisense; AGCAGGCGGTTCTTCAGGCCGTTCG
>probe:Drosophila_2:1633842_at:146:305; Interrogation_Position=1879; Antisense; CCGTTCGTCGCAACTTTGGCGAATT
>probe:Drosophila_2:1633842_at:252:717; Interrogation_Position=1902; Antisense; TTCGGCGGACGAAAGCGCACCAATT
>probe:Drosophila_2:1633842_at:615:205; Interrogation_Position=1914; Antisense; AAGCGCACCAATTTGCGTTTCGTGT

Paste this into a BLAST search page for me
GCAGCAGTCTTAGCCAGCGCAGGACGCAGCAGTTCCTCCATTGGTGGCTAAACAGCAGCAAAAGCGCCGTCGCCAAAGAATCGTCAATTCTACGGCGACGAACAAGGATCCAGTGACGACCACCAGCGTCCCTTCTGGAATATCCTGGGTAATATCCTGGGTCGCCAATCGGATTATCGGATTCGAAGCCCAGTGCGGAATCCACTGTTGTCTCTTCCGAAGAATGAAGAATCCCAAACGGATCCCGTCGAGCAGGCGGTTCTTCAGGCCGTTCGCCGTTCGTCGCAACTTTGGCGAATTTTCGGCGGACGAAAGCGCACCAATTAAGCGCACCAATTTGCGTTTCGTGT

Full Affymetrix probeset data:

Annotations for 1633842_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime