Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633843_at:

>probe:Drosophila_2:1633843_at:707:401; Interrogation_Position=1559; Antisense; GACTTGGCCGACTGTGTGGTTTTAA
>probe:Drosophila_2:1633843_at:480:395; Interrogation_Position=1590; Antisense; GAAATATCGGCCTTCTAACCCAATT
>probe:Drosophila_2:1633843_at:338:681; Interrogation_Position=1657; Antisense; TATGAAGCAACTGCAGCGGCTGTAT
>probe:Drosophila_2:1633843_at:713:115; Interrogation_Position=1707; Antisense; AGCTAAACATTAAGCCGCCCCAGGG
>probe:Drosophila_2:1633843_at:239:81; Interrogation_Position=1728; Antisense; AGGGAAGCCCTTAGGCGAACATAAG
>probe:Drosophila_2:1633843_at:513:147; Interrogation_Position=1746; Antisense; ACATAAGCCACATCCCTCATTGAAT
>probe:Drosophila_2:1633843_at:719:193; Interrogation_Position=1825; Antisense; AACTGAAAGTCTCGGCAACATCCTG
>probe:Drosophila_2:1633843_at:392:631; Interrogation_Position=1845; Antisense; TCCTGGCCTGGATTTAAGTTCGTGT
>probe:Drosophila_2:1633843_at:597:663; Interrogation_Position=1880; Antisense; TAAATGAGTCATCGGCAGCCTGGCT
>probe:Drosophila_2:1633843_at:584:351; Interrogation_Position=1894; Antisense; GCAGCCTGGCTACACTAAGTCAATG
>probe:Drosophila_2:1633843_at:543:113; Interrogation_Position=1937; Antisense; AGCAGCTTAGCTTTGATTTGCCAAA
>probe:Drosophila_2:1633843_at:215:709; Interrogation_Position=1967; Antisense; TTAAATTGCACTACCATTTCATTGG
>probe:Drosophila_2:1633843_at:396:171; Interrogation_Position=2020; Antisense; AAAGTTGCCATTATTGTCATACCAA
>probe:Drosophila_2:1633843_at:276:71; Interrogation_Position=2083; Antisense; AGGAGTCACTTTCATTTCGTAGCCA

Paste this into a BLAST search page for me
GACTTGGCCGACTGTGTGGTTTTAAGAAATATCGGCCTTCTAACCCAATTTATGAAGCAACTGCAGCGGCTGTATAGCTAAACATTAAGCCGCCCCAGGGAGGGAAGCCCTTAGGCGAACATAAGACATAAGCCACATCCCTCATTGAATAACTGAAAGTCTCGGCAACATCCTGTCCTGGCCTGGATTTAAGTTCGTGTTAAATGAGTCATCGGCAGCCTGGCTGCAGCCTGGCTACACTAAGTCAATGAGCAGCTTAGCTTTGATTTGCCAAATTAAATTGCACTACCATTTCATTGGAAAGTTGCCATTATTGTCATACCAAAGGAGTCACTTTCATTTCGTAGCCA

Full Affymetrix probeset data:

Annotations for 1633843_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime