Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633844_at:

>probe:Drosophila_2:1633844_at:619:389; Interrogation_Position=126; Antisense; GAAACGGAATCTGCAGGACTGGTAT
>probe:Drosophila_2:1633844_at:39:591; Interrogation_Position=145; Antisense; TGGTATGTGGACAGTGCTGGCCTCA
>probe:Drosophila_2:1633844_at:107:623; Interrogation_Position=159; Antisense; TGCTGGCCTCAGGAGTTGGAACGTT
>probe:Drosophila_2:1633844_at:176:417; Interrogation_Position=190; Antisense; GAGCCCCAGGCACGTGGACAACAAT
>probe:Drosophila_2:1633844_at:470:149; Interrogation_Position=245; Antisense; ACTTGGGTCGTATGATAAGCGCTCA
>probe:Drosophila_2:1633844_at:401:385; Interrogation_Position=25; Antisense; GAACTTGCAGTTCCCATTGCGAAAA
>probe:Drosophila_2:1633844_at:716:123; Interrogation_Position=262; Antisense; AGCGCTCAAGACTTCTATGACTTCG
>probe:Drosophila_2:1633844_at:170:403; Interrogation_Position=280; Antisense; GACTTCGATTACATATTCGCCATGG
>probe:Drosophila_2:1633844_at:708:9; Interrogation_Position=294; Antisense; ATTCGCCATGGACAATAGCAACCTA
>probe:Drosophila_2:1633844_at:11:359; Interrogation_Position=311; Antisense; GCAACCTATTGGAGCTTGAGCATAT
>probe:Drosophila_2:1633844_at:634:605; Interrogation_Position=327; Antisense; TGAGCATATGGCTGCTTCTCTTACT
>probe:Drosophila_2:1633844_at:617:633; Interrogation_Position=351; Antisense; TCCCAGTCCGACATGCAAGATTCAA
>probe:Drosophila_2:1633844_at:243:509; Interrogation_Position=66; Antisense; GTGCATTGGCAACACATGCCGGTCA
>probe:Drosophila_2:1633844_at:607:581; Interrogation_Position=95; Antisense; TGGCCGAGGCCATACTGAAGCATTT

Paste this into a BLAST search page for me
GAAACGGAATCTGCAGGACTGGTATTGGTATGTGGACAGTGCTGGCCTCATGCTGGCCTCAGGAGTTGGAACGTTGAGCCCCAGGCACGTGGACAACAATACTTGGGTCGTATGATAAGCGCTCAGAACTTGCAGTTCCCATTGCGAAAAAGCGCTCAAGACTTCTATGACTTCGGACTTCGATTACATATTCGCCATGGATTCGCCATGGACAATAGCAACCTAGCAACCTATTGGAGCTTGAGCATATTGAGCATATGGCTGCTTCTCTTACTTCCCAGTCCGACATGCAAGATTCAAGTGCATTGGCAACACATGCCGGTCATGGCCGAGGCCATACTGAAGCATTT

Full Affymetrix probeset data:

Annotations for 1633844_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime