Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633845_at:

>probe:Drosophila_2:1633845_at:396:353; Interrogation_Position=1179; Antisense; GCAGCTGGCCAAGCTAGTGGCTACG
>probe:Drosophila_2:1633845_at:713:665; Interrogation_Position=1200; Antisense; TACGGTGGTGCGTCATTTCCGGGAA
>probe:Drosophila_2:1633845_at:536:505; Interrogation_Position=1272; Antisense; GTCCAAGCAGGCCATGCACTATGTG
>probe:Drosophila_2:1633845_at:660:681; Interrogation_Position=1291; Antisense; TATGTGCACTGCAATGCCAGCCTCT
>probe:Drosophila_2:1633845_at:123:611; Interrogation_Position=1319; Antisense; TGACCAGCAATCTGTCGCACGATGA
>probe:Drosophila_2:1633845_at:98:445; Interrogation_Position=1339; Antisense; GATGATCCCTTCCTGCTGTATGCCA
>probe:Drosophila_2:1633845_at:396:119; Interrogation_Position=1372; Antisense; AGCGGCCAGGAGACAGACTTCTTCT
>probe:Drosophila_2:1633845_at:130:615; Interrogation_Position=1442; Antisense; TGAAGCCCATCTTTCGTCGCTGGCA
>probe:Drosophila_2:1633845_at:269:687; Interrogation_Position=1515; Antisense; TATAGTCAAGGAGCCCGTTCGTCAT
>probe:Drosophila_2:1633845_at:108:583; Interrogation_Position=1559; Antisense; TGGCGGACACCTGGCATGTGCCCTA
>probe:Drosophila_2:1633845_at:127:347; Interrogation_Position=1602; Antisense; GCATCCCACAGACAGCTTCGAGGTG
>probe:Drosophila_2:1633845_at:681:311; Interrogation_Position=1630; Antisense; GCCAACTGGCTGTGCATCCAGATGA
>probe:Drosophila_2:1633845_at:177:615; Interrogation_Position=1652; Antisense; TGAAGGAGCAGACGATACCCGCCAC
>probe:Drosophila_2:1633845_at:523:533; Interrogation_Position=1700; Antisense; GGTGACCATGTGAGCAAGACTTCTT

Paste this into a BLAST search page for me
GCAGCTGGCCAAGCTAGTGGCTACGTACGGTGGTGCGTCATTTCCGGGAAGTCCAAGCAGGCCATGCACTATGTGTATGTGCACTGCAATGCCAGCCTCTTGACCAGCAATCTGTCGCACGATGAGATGATCCCTTCCTGCTGTATGCCAAGCGGCCAGGAGACAGACTTCTTCTTGAAGCCCATCTTTCGTCGCTGGCATATAGTCAAGGAGCCCGTTCGTCATTGGCGGACACCTGGCATGTGCCCTAGCATCCCACAGACAGCTTCGAGGTGGCCAACTGGCTGTGCATCCAGATGATGAAGGAGCAGACGATACCCGCCACGGTGACCATGTGAGCAAGACTTCTT

Full Affymetrix probeset data:

Annotations for 1633845_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime