Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633846_at:

>probe:Drosophila_2:1633846_at:461:513; Interrogation_Position=10280; Antisense; GTGTTCTGCATACGGTGGGCTTTAA
>probe:Drosophila_2:1633846_at:376:231; Interrogation_Position=10303; Antisense; AATGCTATGCCCCAACAGGTTGAGC
>probe:Drosophila_2:1633846_at:686:77; Interrogation_Position=10319; Antisense; AGGTTGAGCCCAGTTTCATTCGAAA
>probe:Drosophila_2:1633846_at:298:11; Interrogation_Position=10336; Antisense; ATTCGAAACGTTGCCCTGCATGGAA
>probe:Drosophila_2:1633846_at:96:681; Interrogation_Position=10373; Antisense; TATGGAGCTATTTGCCCGAGGAGTT
>probe:Drosophila_2:1633846_at:537:125; Interrogation_Position=10399; Antisense; AGCCGCGATCAGATGCTGTTCTTTA
>probe:Drosophila_2:1633846_at:373:479; Interrogation_Position=10470; Antisense; GTTTCTAACCTCGTCAGTATTGGCC
>probe:Drosophila_2:1633846_at:720:477; Interrogation_Position=10486; Antisense; GTATTGGCCATCATGCAGTCGGATA
>probe:Drosophila_2:1633846_at:522:373; Interrogation_Position=10567; Antisense; GAAGATCCCTCCAAACTGTACTTGA
>probe:Drosophila_2:1633846_at:295:373; Interrogation_Position=10621; Antisense; GAAGGGCAACTCAACTACACCAATG
>probe:Drosophila_2:1633846_at:299:55; Interrogation_Position=10654; Antisense; ATGAAGTTCCTGAATGCCTCTCGAC
>probe:Drosophila_2:1633846_at:198:209; Interrogation_Position=10683; Antisense; AAGCATCGCCAACGATTCGCTGAAT
>probe:Drosophila_2:1633846_at:671:595; Interrogation_Position=10734; Antisense; TGTGGACGACCGAATCCAGCGGCAA
>probe:Drosophila_2:1633846_at:598:249; Interrogation_Position=10756; Antisense; CAATCGCAGTGCATCTTCTACATTA

Paste this into a BLAST search page for me
GTGTTCTGCATACGGTGGGCTTTAAAATGCTATGCCCCAACAGGTTGAGCAGGTTGAGCCCAGTTTCATTCGAAAATTCGAAACGTTGCCCTGCATGGAATATGGAGCTATTTGCCCGAGGAGTTAGCCGCGATCAGATGCTGTTCTTTAGTTTCTAACCTCGTCAGTATTGGCCGTATTGGCCATCATGCAGTCGGATAGAAGATCCCTCCAAACTGTACTTGAGAAGGGCAACTCAACTACACCAATGATGAAGTTCCTGAATGCCTCTCGACAAGCATCGCCAACGATTCGCTGAATTGTGGACGACCGAATCCAGCGGCAACAATCGCAGTGCATCTTCTACATTA

Full Affymetrix probeset data:

Annotations for 1633846_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime