Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633847_at:

>probe:Drosophila_2:1633847_at:471:505; Interrogation_Position=1396; Antisense; GTCCAAGTTATAATGTGCTTGCCAT
>probe:Drosophila_2:1633847_at:455:509; Interrogation_Position=1410; Antisense; GTGCTTGCCATATGACTTGGATACA
>probe:Drosophila_2:1633847_at:123:543; Interrogation_Position=1428; Antisense; GGATACAATTCTACAATTCCCGCTC
>probe:Drosophila_2:1633847_at:357:695; Interrogation_Position=1468; Antisense; TTTCCAACCTTTCGCGCAATTTTCT
>probe:Drosophila_2:1633847_at:705:299; Interrogation_Position=1494; Antisense; CGCCCAATCGCCTATCTAAACTATA
>probe:Drosophila_2:1633847_at:566:17; Interrogation_Position=1532; Antisense; ATTTATCTGTCTATGGTTGTCTGTA
>probe:Drosophila_2:1633847_at:699:497; Interrogation_Position=1540; Antisense; GTCTATGGTTGTCTGTAAGCTGCTT
>probe:Drosophila_2:1633847_at:31:659; Interrogation_Position=1555; Antisense; TAAGCTGCTTTTGTTATTTGCCTCA
>probe:Drosophila_2:1633847_at:584:19; Interrogation_Position=1570; Antisense; ATTTGCCTCATGTACATAGCGTTAT
>probe:Drosophila_2:1633847_at:152:231; Interrogation_Position=1691; Antisense; AATTTTAGTCGGAGCACGCGGTTGC
>probe:Drosophila_2:1633847_at:53:261; Interrogation_Position=1705; Antisense; CACGCGGTTGCCTTGCATTGAATAT
>probe:Drosophila_2:1633847_at:111:393; Interrogation_Position=1736; Antisense; GAAATATCGGGCACAACTACTTAAG
>probe:Drosophila_2:1633847_at:83:401; Interrogation_Position=1760; Antisense; GACATCTACAAGAGACGTAATCCTA
>probe:Drosophila_2:1633847_at:571:185; Interrogation_Position=1848; Antisense; AACACATTTTGTATGTCCAAACTGA

Paste this into a BLAST search page for me
GTCCAAGTTATAATGTGCTTGCCATGTGCTTGCCATATGACTTGGATACAGGATACAATTCTACAATTCCCGCTCTTTCCAACCTTTCGCGCAATTTTCTCGCCCAATCGCCTATCTAAACTATAATTTATCTGTCTATGGTTGTCTGTAGTCTATGGTTGTCTGTAAGCTGCTTTAAGCTGCTTTTGTTATTTGCCTCAATTTGCCTCATGTACATAGCGTTATAATTTTAGTCGGAGCACGCGGTTGCCACGCGGTTGCCTTGCATTGAATATGAAATATCGGGCACAACTACTTAAGGACATCTACAAGAGACGTAATCCTAAACACATTTTGTATGTCCAAACTGA

Full Affymetrix probeset data:

Annotations for 1633847_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime