FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633849_at:

>probe:Drosophila_2:1633849_at:160:535; Interrogation_Position=1445; Antisense; GGTCCAAGAAGTCCGTGCACCGCAA
>probe:Drosophila_2:1633849_at:242:203; Interrogation_Position=1468; Antisense; AACCACTTCACTGCCGAGTTCGTGG
>probe:Drosophila_2:1633849_at:301:93; Interrogation_Position=1484; Antisense; AGTTCGTGGCCCTCAAGTGCATGAA
>probe:Drosophila_2:1633849_at:346:593; Interrogation_Position=1520; Antisense; TGGGCCTGGTCAAGTGCCACAATTG
>probe:Drosophila_2:1633849_at:665:161; Interrogation_Position=1538; Antisense; ACAATTGCTGAGTCGCAGTCCGAGT
>probe:Drosophila_2:1633849_at:414:267; Interrogation_Position=1553; Antisense; CAGTCCGAGTCCCAGTTCTAGAATT
>probe:Drosophila_2:1633849_at:727:471; Interrogation_Position=1567; Antisense; GTTCTAGAATTCGTAAGCCCAGTTA
>probe:Drosophila_2:1633849_at:426:205; Interrogation_Position=1581; Antisense; AAGCCCAGTTAGTCTAAGCCGCTAA
>probe:Drosophila_2:1633849_at:260:205; Interrogation_Position=1596; Antisense; AAGCCGCTAAAATCCAATACTCTCG
>probe:Drosophila_2:1633849_at:532:27; Interrogation_Position=1612; Antisense; ATACTCTCGGAATATGCTAGGCTTA
>probe:Drosophila_2:1633849_at:202:25; Interrogation_Position=1645; Antisense; ATAGCTAATCCGTACCAGGGTCTGT
>probe:Drosophila_2:1633849_at:456:307; Interrogation_Position=1659; Antisense; CCAGGGTCTGTGTTTTCATTTTCGA
>probe:Drosophila_2:1633849_at:185:641; Interrogation_Position=1794; Antisense; TCTGCTAACTCCTGCTAATGTGTCA
>probe:Drosophila_2:1633849_at:27:53; Interrogation_Position=1875; Antisense; ATGTTTGTTTAATCGGTGAATCCCA

Paste this into a BLAST search page for me
GGTCCAAGAAGTCCGTGCACCGCAAAACCACTTCACTGCCGAGTTCGTGGAGTTCGTGGCCCTCAAGTGCATGAATGGGCCTGGTCAAGTGCCACAATTGACAATTGCTGAGTCGCAGTCCGAGTCAGTCCGAGTCCCAGTTCTAGAATTGTTCTAGAATTCGTAAGCCCAGTTAAAGCCCAGTTAGTCTAAGCCGCTAAAAGCCGCTAAAATCCAATACTCTCGATACTCTCGGAATATGCTAGGCTTAATAGCTAATCCGTACCAGGGTCTGTCCAGGGTCTGTGTTTTCATTTTCGATCTGCTAACTCCTGCTAATGTGTCAATGTTTGTTTAATCGGTGAATCCCA

Full Affymetrix probeset data:

Annotations for 1633849_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720