FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633850_at:

>probe:Drosophila_2:1633850_at:197:75; Interrogation_Position=287; Antisense; AGGAGACCGTTGAGCGTCGTTTCCA
>probe:Drosophila_2:1633850_at:509:205; Interrogation_Position=335; Antisense; AAGCCCTCAGGGAACTGGACAGCAA
>probe:Drosophila_2:1633850_at:400:399; Interrogation_Position=352; Antisense; GACAGCAAAGTGTTCCACGTTCCAC
>probe:Drosophila_2:1633850_at:352:261; Interrogation_Position=374; Antisense; CACCGCATGTGCTGCATCCGGAGCA
>probe:Drosophila_2:1633850_at:442:47; Interrogation_Position=389; Antisense; ATCCGGAGCACATGTTCGTCGAGAA
>probe:Drosophila_2:1633850_at:302:469; Interrogation_Position=402; Antisense; GTTCGTCGAGAATCAGTATACCAGC
>probe:Drosophila_2:1633850_at:481:423; Interrogation_Position=481; Antisense; GAGAACATGGCCATGCTGGCGCATT
>probe:Drosophila_2:1633850_at:70:271; Interrogation_Position=492; Antisense; CATGCTGGCGCATTTGAAGATCGAG
>probe:Drosophila_2:1633850_at:152:301; Interrogation_Position=531; Antisense; CGCCATGGAGGATCTCATCCAGAAG
>probe:Drosophila_2:1633850_at:645:53; Interrogation_Position=565; Antisense; ATGCAGGATCGCGTGCAGCGAAGCT
>probe:Drosophila_2:1633850_at:206:247; Interrogation_Position=620; Antisense; AATTCTGGAATCAAGTGCCCCTGCA
>probe:Drosophila_2:1633850_at:32:279; Interrogation_Position=695; Antisense; CTACATTTCCAATATCTTCTTTCGA
>probe:Drosophila_2:1633850_at:116:675; Interrogation_Position=723; Antisense; TAGTTTTAACCCTGGAGTCATTTAT
>probe:Drosophila_2:1633850_at:674:103; Interrogation_Position=756; Antisense; AGACTCTTCTATATTCCACTTTACC

Paste this into a BLAST search page for me
AGGAGACCGTTGAGCGTCGTTTCCAAAGCCCTCAGGGAACTGGACAGCAAGACAGCAAAGTGTTCCACGTTCCACCACCGCATGTGCTGCATCCGGAGCAATCCGGAGCACATGTTCGTCGAGAAGTTCGTCGAGAATCAGTATACCAGCGAGAACATGGCCATGCTGGCGCATTCATGCTGGCGCATTTGAAGATCGAGCGCCATGGAGGATCTCATCCAGAAGATGCAGGATCGCGTGCAGCGAAGCTAATTCTGGAATCAAGTGCCCCTGCACTACATTTCCAATATCTTCTTTCGATAGTTTTAACCCTGGAGTCATTTATAGACTCTTCTATATTCCACTTTACC

Full Affymetrix probeset data:

Annotations for 1633850_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720