Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633851_at:

>probe:Drosophila_2:1633851_at:724:613; Interrogation_Position=1613; Antisense; TGAACCTTCACAACCTGGCATTTGT
>probe:Drosophila_2:1633851_at:472:423; Interrogation_Position=1672; Antisense; GAGACGCTGACCATTTCGCAAATGC
>probe:Drosophila_2:1633851_at:340:621; Interrogation_Position=1694; Antisense; TGCTGTGCGCCAACGAATCCATAAT
>probe:Drosophila_2:1633851_at:17:77; Interrogation_Position=1751; Antisense; AGGATGTTGCGGTCATGCAGTCGAA
>probe:Drosophila_2:1633851_at:366:107; Interrogation_Position=1814; Antisense; AGAAGCGGGACATGATCTCCTACAT
>probe:Drosophila_2:1633851_at:198:153; Interrogation_Position=1835; Antisense; ACATGCTCTCCAAGGCGAGGGCCGA
>probe:Drosophila_2:1633851_at:447:119; Interrogation_Position=1889; Antisense; AGCTGCGCAAGGATCTGACCAGGCT
>probe:Drosophila_2:1633851_at:354:103; Interrogation_Position=1958; Antisense; AGACCAAGGGCGGACTGCTGTTCAA
>probe:Drosophila_2:1633851_at:384:653; Interrogation_Position=1979; Antisense; TCAAGCCGGGCCTGATGTACGACTA
>probe:Drosophila_2:1633851_at:85:405; Interrogation_Position=1999; Antisense; GACTACGATAAGTGCATGGCCGATA
>probe:Drosophila_2:1633851_at:384:293; Interrogation_Position=2035; Antisense; CGTAGTCACATCCAGGCCATGAAGA
>probe:Drosophila_2:1633851_at:142:427; Interrogation_Position=2071; Antisense; GAGTTGGGTAAACGCATTCGCGCCT
>probe:Drosophila_2:1633851_at:593:315; Interrogation_Position=2092; Antisense; GCCTGCGAAGACTCCAAGTACCAGT
>probe:Drosophila_2:1633851_at:613:485; Interrogation_Position=2109; Antisense; GTACCAGTCCAGTTTTTCGATACGG

Paste this into a BLAST search page for me
TGAACCTTCACAACCTGGCATTTGTGAGACGCTGACCATTTCGCAAATGCTGCTGTGCGCCAACGAATCCATAATAGGATGTTGCGGTCATGCAGTCGAAAGAAGCGGGACATGATCTCCTACATACATGCTCTCCAAGGCGAGGGCCGAAGCTGCGCAAGGATCTGACCAGGCTAGACCAAGGGCGGACTGCTGTTCAATCAAGCCGGGCCTGATGTACGACTAGACTACGATAAGTGCATGGCCGATACGTAGTCACATCCAGGCCATGAAGAGAGTTGGGTAAACGCATTCGCGCCTGCCTGCGAAGACTCCAAGTACCAGTGTACCAGTCCAGTTTTTCGATACGG

Full Affymetrix probeset data:

Annotations for 1633851_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime