Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633852_at:

>probe:Drosophila_2:1633852_at:565:463; Interrogation_Position=1014; Antisense; GATTCGGATTCGTGACCATGACCAA
>probe:Drosophila_2:1633852_at:365:305; Interrogation_Position=1050; Antisense; CCGTGGTGGCCATTCAGTCGCTGAA
>probe:Drosophila_2:1633852_at:501:333; Interrogation_Position=1069; Antisense; GCTGAATGGTTATACCCTGGGCAAT
>probe:Drosophila_2:1633852_at:683:409; Interrogation_Position=1126; Antisense; GACCAAAACCACTTAGGCGAACCAG
>probe:Drosophila_2:1633852_at:518:127; Interrogation_Position=1149; Antisense; AGCCAATCTGGACTAGACCTTTCCA
>probe:Drosophila_2:1633852_at:130:693; Interrogation_Position=1168; Antisense; TTTCCAATACTCCACGATCTGTTTG
>probe:Drosophila_2:1633852_at:316:123; Interrogation_Position=1299; Antisense; AGCGCGAGTTTATGATATGTCTATC
>probe:Drosophila_2:1633852_at:452:707; Interrogation_Position=857; Antisense; TTACCGGGAAATGCCATGACTGGAT
>probe:Drosophila_2:1633852_at:382:407; Interrogation_Position=874; Antisense; GACTGGATCGGGATGGTGCATATTC
>probe:Drosophila_2:1633852_at:436:509; Interrogation_Position=889; Antisense; GTGCATATTCGTCTATAACCTGGCC
>probe:Drosophila_2:1633852_at:171:623; Interrogation_Position=933; Antisense; TGCTGTGGCAGCTATTCGGGCCATT
>probe:Drosophila_2:1633852_at:498:1; Interrogation_Position=955; Antisense; ATTCGGTGCCGTTCAATCGGTGAAG
>probe:Drosophila_2:1633852_at:716:603; Interrogation_Position=981; Antisense; TGATCCGGGATCTGCAGACCAGCAA
>probe:Drosophila_2:1633852_at:402:309; Interrogation_Position=999; Antisense; CCAGCAAGTGCAAGGGATTCGGATT

Paste this into a BLAST search page for me
GATTCGGATTCGTGACCATGACCAACCGTGGTGGCCATTCAGTCGCTGAAGCTGAATGGTTATACCCTGGGCAATGACCAAAACCACTTAGGCGAACCAGAGCCAATCTGGACTAGACCTTTCCATTTCCAATACTCCACGATCTGTTTGAGCGCGAGTTTATGATATGTCTATCTTACCGGGAAATGCCATGACTGGATGACTGGATCGGGATGGTGCATATTCGTGCATATTCGTCTATAACCTGGCCTGCTGTGGCAGCTATTCGGGCCATTATTCGGTGCCGTTCAATCGGTGAAGTGATCCGGGATCTGCAGACCAGCAACCAGCAAGTGCAAGGGATTCGGATT

Full Affymetrix probeset data:

Annotations for 1633852_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime