Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633854_at:

>probe:Drosophila_2:1633854_at:463:283; Interrogation_Position=1016; Antisense; CTGCGCGTGGCGAACTAGAATCTTA
>probe:Drosophila_2:1633854_at:474:549; Interrogation_Position=1056; Antisense; GGAGGATGGAGCACACTCGCGACTC
>probe:Drosophila_2:1633854_at:224:635; Interrogation_Position=1072; Antisense; TCGCGACTCGTTTGGGAGAGCTTCA
>probe:Drosophila_2:1633854_at:263:425; Interrogation_Position=1087; Antisense; GAGAGCTTCATTAAGTACGCCAACT
>probe:Drosophila_2:1633854_at:560:423; Interrogation_Position=1116; Antisense; GAGAACATCCACGACAAGTGCCTGG
>probe:Drosophila_2:1633854_at:714:219; Interrogation_Position=1131; Antisense; AAGTGCCTGGAGTCGCAAGCTGAAG
>probe:Drosophila_2:1633854_at:552:393; Interrogation_Position=1168; Antisense; GAAATCCAGCTTGGACTGCTCTATC
>probe:Drosophila_2:1633854_at:19:621; Interrogation_Position=1184; Antisense; TGCTCTATCCTCGTTTGGACATCAA
>probe:Drosophila_2:1633854_at:573:169; Interrogation_Position=1236; Antisense; AAAGGCACCGTTTTGCATTCATCCA
>probe:Drosophila_2:1633854_at:211:171; Interrogation_Position=1270; Antisense; AAAGTGTGCGTTCCGTTTAGTGTGA
>probe:Drosophila_2:1633854_at:341:433; Interrogation_Position=1293; Antisense; GAGTGCTGTGGCCAAGTTTGATCCC
>probe:Drosophila_2:1633854_at:40:651; Interrogation_Position=1334; Antisense; TCACCCAGTTGCTTCACGAGATCAA
>probe:Drosophila_2:1633854_at:60:267; Interrogation_Position=1437; Antisense; CATGTTCAAGGGTGTCGTGGTTTTC
>probe:Drosophila_2:1633854_at:605:661; Interrogation_Position=996; Antisense; TAACATGGTCCACGATGACGCTGCG

Paste this into a BLAST search page for me
CTGCGCGTGGCGAACTAGAATCTTAGGAGGATGGAGCACACTCGCGACTCTCGCGACTCGTTTGGGAGAGCTTCAGAGAGCTTCATTAAGTACGCCAACTGAGAACATCCACGACAAGTGCCTGGAAGTGCCTGGAGTCGCAAGCTGAAGGAAATCCAGCTTGGACTGCTCTATCTGCTCTATCCTCGTTTGGACATCAAAAAGGCACCGTTTTGCATTCATCCAAAAGTGTGCGTTCCGTTTAGTGTGAGAGTGCTGTGGCCAAGTTTGATCCCTCACCCAGTTGCTTCACGAGATCAACATGTTCAAGGGTGTCGTGGTTTTCTAACATGGTCCACGATGACGCTGCG

Full Affymetrix probeset data:

Annotations for 1633854_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime