Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633857_at:

>probe:Drosophila_2:1633857_at:463:123; Interrogation_Position=1019; Antisense; ACCAAGGATCAATGCCGACGGAACA
>probe:Drosophila_2:1633857_at:585:429; Interrogation_Position=1081; Antisense; GAGTTTCTACTGCTGAGCACATTCT
>probe:Drosophila_2:1633857_at:511:421; Interrogation_Position=1095; Antisense; GAGCACATTCTTGCCAGTTTCGATT
>probe:Drosophila_2:1633857_at:276:385; Interrogation_Position=673; Antisense; GAACTCAGCAAATACCAGCCGCATT
>probe:Drosophila_2:1633857_at:689:549; Interrogation_Position=747; Antisense; GGAGTATCGAAACAATCCCCAGCCA
>probe:Drosophila_2:1633857_at:323:127; Interrogation_Position=767; Antisense; AGCCAGGATACAACGTTCTCTGCCA
>probe:Drosophila_2:1633857_at:465:275; Interrogation_Position=798; Antisense; CTTCCATTCCCGCAACATGATGTTT
>probe:Drosophila_2:1633857_at:87:391; Interrogation_Position=835; Antisense; GAAACAGGATGCTTCGAGGACTGCA
>probe:Drosophila_2:1633857_at:512:283; Interrogation_Position=855; Antisense; CTGCATGCTGCTGGATTATCAGGGC
>probe:Drosophila_2:1633857_at:59:705; Interrogation_Position=870; Antisense; TTATCAGGGCTGTAATGTGGCTCCA
>probe:Drosophila_2:1633857_at:58:65; Interrogation_Position=884; Antisense; ATGTGGCTCCAATGGCCGTTGATCT
>probe:Drosophila_2:1633857_at:86:579; Interrogation_Position=897; Antisense; GGCCGTTGATCTTATGTACTCCATT
>probe:Drosophila_2:1633857_at:367:727; Interrogation_Position=967; Antisense; TTGTTAAACTACTACCTATCCATCC
>probe:Drosophila_2:1633857_at:407:403; Interrogation_Position=999; Antisense; GACTCTCAAGAAGATTGGCTACCAA

Paste this into a BLAST search page for me
ACCAAGGATCAATGCCGACGGAACAGAGTTTCTACTGCTGAGCACATTCTGAGCACATTCTTGCCAGTTTCGATTGAACTCAGCAAATACCAGCCGCATTGGAGTATCGAAACAATCCCCAGCCAAGCCAGGATACAACGTTCTCTGCCACTTCCATTCCCGCAACATGATGTTTGAAACAGGATGCTTCGAGGACTGCACTGCATGCTGCTGGATTATCAGGGCTTATCAGGGCTGTAATGTGGCTCCAATGTGGCTCCAATGGCCGTTGATCTGGCCGTTGATCTTATGTACTCCATTTTGTTAAACTACTACCTATCCATCCGACTCTCAAGAAGATTGGCTACCAA

Full Affymetrix probeset data:

Annotations for 1633857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime