FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633858_at:

>probe:Drosophila_2:1633858_at:480:689; Interrogation_Position=260; Antisense; TATTGCGCGGCCAGGATCCCATGAA
>probe:Drosophila_2:1633858_at:688:479; Interrogation_Position=329; Antisense; GTTTGGGATCCAATGTGCCCGAACC
>probe:Drosophila_2:1633858_at:304:205; Interrogation_Position=355; Antisense; AAGCCGGATCCATGTGCTACCAAGA
>probe:Drosophila_2:1633858_at:101:213; Interrogation_Position=376; Antisense; AAGACACCGGAGAACACATTGGCCT
>probe:Drosophila_2:1633858_at:714:211; Interrogation_Position=430; Antisense; AAGACCTCCGTGGTTCTCGAAGAGC
>probe:Drosophila_2:1633858_at:387:607; Interrogation_Position=446; Antisense; TCGAAGAGCTAACCAAGCCGGCCAT
>probe:Drosophila_2:1633858_at:421:1; Interrogation_Position=474; Antisense; AAATCCGGCTTTCAACAAATCCCTG
>probe:Drosophila_2:1633858_at:348:283; Interrogation_Position=496; Antisense; CTGCCGCCGTACTTCGATGAAGAGA
>probe:Drosophila_2:1633858_at:378:609; Interrogation_Position=545; Antisense; TGAAGTTCCGTTTCCGGCGCAAGTT
>probe:Drosophila_2:1633858_at:164:111; Interrogation_Position=587; Antisense; AGAAGGCCGGCAACCTGATGTGCAC
>probe:Drosophila_2:1633858_at:67:639; Interrogation_Position=635; Antisense; TCGTGTTGACCAACTGTTGCGACGT
>probe:Drosophila_2:1633858_at:117:297; Interrogation_Position=654; Antisense; CGACGTGATGGTCTGGCCCAGTCAA
>probe:Drosophila_2:1633858_at:234:325; Interrogation_Position=722; Antisense; GCGAAGCCGATCTCACGGAGTACAT
>probe:Drosophila_2:1633858_at:78:343; Interrogation_Position=793; Antisense; GCTTTTTGGCACATAACGCCGATCA

Paste this into a BLAST search page for me
TATTGCGCGGCCAGGATCCCATGAAGTTTGGGATCCAATGTGCCCGAACCAAGCCGGATCCATGTGCTACCAAGAAAGACACCGGAGAACACATTGGCCTAAGACCTCCGTGGTTCTCGAAGAGCTCGAAGAGCTAACCAAGCCGGCCATAAATCCGGCTTTCAACAAATCCCTGCTGCCGCCGTACTTCGATGAAGAGATGAAGTTCCGTTTCCGGCGCAAGTTAGAAGGCCGGCAACCTGATGTGCACTCGTGTTGACCAACTGTTGCGACGTCGACGTGATGGTCTGGCCCAGTCAAGCGAAGCCGATCTCACGGAGTACATGCTTTTTGGCACATAACGCCGATCA

Full Affymetrix probeset data:

Annotations for 1633858_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720