FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633860_at:

>probe:Drosophila_2:1633860_at:260:183; Interrogation_Position=145; Antisense; AAAAGCCGACTGAGTCTCGTGGCCA
>probe:Drosophila_2:1633860_at:159:599; Interrogation_Position=264; Antisense; TGACTTTAAGTTCTACTTGCCGGCC
>probe:Drosophila_2:1633860_at:175:555; Interrogation_Position=292; Antisense; GGAGCCACCATCTATGTCTACAAGC
>probe:Drosophila_2:1633860_at:705:629; Interrogation_Position=335; Antisense; TCCTCGATCGCGTATCCAAGTGGTA
>probe:Drosophila_2:1633860_at:323:221; Interrogation_Position=352; Antisense; AAGTGGTACGACCTGACTGTCTTCA
>probe:Drosophila_2:1633860_at:633:415; Interrogation_Position=383; Antisense; GAGCCGAGATATATGCCTCTCCGAT
>probe:Drosophila_2:1633860_at:357:171; Interrogation_Position=483; Antisense; AAAGTGGTCCAAGTCCGTACTGCTG
>probe:Drosophila_2:1633860_at:551:319; Interrogation_Position=512; Antisense; GCCCGGATTTGTCCAATGTTGTGCT
>probe:Drosophila_2:1633860_at:573:331; Interrogation_Position=571; Antisense; GCGGAAAACGCCATTCTCATCAAGT
>probe:Drosophila_2:1633860_at:396:219; Interrogation_Position=592; Antisense; AAGTCCTATGAAATCGGCTGTCGCG
>probe:Drosophila_2:1633860_at:456:409; Interrogation_Position=616; Antisense; GACGAGGCCCTCATCAATTTGTTAC
>probe:Drosophila_2:1633860_at:471:555; Interrogation_Position=648; Antisense; GGACGCCCTGCGATTCATGAAGGAT
>probe:Drosophila_2:1633860_at:568:441; Interrogation_Position=670; Antisense; GATGTGCGATCGATGCTCAAACGTT
>probe:Drosophila_2:1633860_at:146:651; Interrogation_Position=686; Antisense; TCAAACGTTGCACTCGCTTCGAAAG

Paste this into a BLAST search page for me
AAAAGCCGACTGAGTCTCGTGGCCATGACTTTAAGTTCTACTTGCCGGCCGGAGCCACCATCTATGTCTACAAGCTCCTCGATCGCGTATCCAAGTGGTAAAGTGGTACGACCTGACTGTCTTCAGAGCCGAGATATATGCCTCTCCGATAAAGTGGTCCAAGTCCGTACTGCTGGCCCGGATTTGTCCAATGTTGTGCTGCGGAAAACGCCATTCTCATCAAGTAAGTCCTATGAAATCGGCTGTCGCGGACGAGGCCCTCATCAATTTGTTACGGACGCCCTGCGATTCATGAAGGATGATGTGCGATCGATGCTCAAACGTTTCAAACGTTGCACTCGCTTCGAAAG

Full Affymetrix probeset data:

Annotations for 1633860_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720