Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633861_at:

>probe:Drosophila_2:1633861_at:645:489; Interrogation_Position=1023; Antisense; GTACATGTCCATGCTCAGTTTTGAA
>probe:Drosophila_2:1633861_at:589:545; Interrogation_Position=1050; Antisense; GGATGAAACCTGGTCCCAAGGCACT
>probe:Drosophila_2:1633861_at:332:143; Interrogation_Position=1077; Antisense; ACTGACCACTTCCATTGACGAGGAT
>probe:Drosophila_2:1633861_at:521:409; Interrogation_Position=1093; Antisense; GACGAGGATCTGGTGCAGTCGCAAT
>probe:Drosophila_2:1633861_at:608:501; Interrogation_Position=1110; Antisense; GTCGCAATTCGACCTTTTGTGTCAG
>probe:Drosophila_2:1633861_at:706:163; Interrogation_Position=610; Antisense; AAATCATCTCTGGTCAGGCATCAGT
>probe:Drosophila_2:1633861_at:57:365; Interrogation_Position=647; Antisense; GAATAAGACCATATCCCTGCAAGGA
>probe:Drosophila_2:1633861_at:217:433; Interrogation_Position=670; Antisense; GAGTGCCCAAAGACCTTTCTGGTAG
>probe:Drosophila_2:1633861_at:426:339; Interrogation_Position=770; Antisense; GCTACTTCTCCGTGGTGGGCAGGAA
>probe:Drosophila_2:1633861_at:569:137; Interrogation_Position=818; Antisense; ACGAGCGACCATTTGTGTGCGATCA
>probe:Drosophila_2:1633861_at:434:73; Interrogation_Position=862; Antisense; AGGACCTGCATTCTGAAGGCCCACA
>probe:Drosophila_2:1633861_at:132:259; Interrogation_Position=883; Antisense; CACATGGCGGTCCACCAAGTTGTAA
>probe:Drosophila_2:1633861_at:441:327; Interrogation_Position=929; Antisense; GCGATCGTTCGTTCAGCCTGAAGAA
>probe:Drosophila_2:1633861_at:713:613; Interrogation_Position=947; Antisense; TGAAGAAACATCTCGCTACGCACTT

Paste this into a BLAST search page for me
GTACATGTCCATGCTCAGTTTTGAAGGATGAAACCTGGTCCCAAGGCACTACTGACCACTTCCATTGACGAGGATGACGAGGATCTGGTGCAGTCGCAATGTCGCAATTCGACCTTTTGTGTCAGAAATCATCTCTGGTCAGGCATCAGTGAATAAGACCATATCCCTGCAAGGAGAGTGCCCAAAGACCTTTCTGGTAGGCTACTTCTCCGTGGTGGGCAGGAAACGAGCGACCATTTGTGTGCGATCAAGGACCTGCATTCTGAAGGCCCACACACATGGCGGTCCACCAAGTTGTAAGCGATCGTTCGTTCAGCCTGAAGAATGAAGAAACATCTCGCTACGCACTT

Full Affymetrix probeset data:

Annotations for 1633861_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime