Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633862_at:

>probe:Drosophila_2:1633862_at:561:171; Interrogation_Position=260; Antisense; AAAGTTCTTCTCAGGTCGAGTCGAG
>probe:Drosophila_2:1633862_at:457:651; Interrogation_Position=291; Antisense; TCACACCGTGGACTTTGAGATCAAG
>probe:Drosophila_2:1633862_at:312:127; Interrogation_Position=329; Antisense; AGCCACCCCAGCGATTGGAGTTTGA
>probe:Drosophila_2:1633862_at:552:421; Interrogation_Position=370; Antisense; GAGCAAAACTCTCCTCAGGGACATT
>probe:Drosophila_2:1633862_at:218:367; Interrogation_Position=389; Antisense; GACATTTGGTTTCTTTGGGCGTCAA
>probe:Drosophila_2:1633862_at:200:109; Interrogation_Position=425; Antisense; AGAAGCCACCTCAGCACTTGGAGGT
>probe:Drosophila_2:1633862_at:199:109; Interrogation_Position=524; Antisense; AGAAGCCTCCACAGCACTTGGAAAT
>probe:Drosophila_2:1633862_at:346:455; Interrogation_Position=552; Antisense; GATCAAGCCTGTTGACCAGAAGCCA
>probe:Drosophila_2:1633862_at:255:133; Interrogation_Position=576; Antisense; ACCGCACCGTGTGGAGCTTGAAGTC
>probe:Drosophila_2:1633862_at:211:343; Interrogation_Position=591; Antisense; GCTTGAAGTCCAACAGCAGCATCAC
>probe:Drosophila_2:1633862_at:410:527; Interrogation_Position=630; Antisense; GGGACACTTGGTTTCTTTGGGAGCA
>probe:Drosophila_2:1633862_at:441:419; Interrogation_Position=733; Antisense; GAGCTTATGGTATTCCAACTGCAGA
>probe:Drosophila_2:1633862_at:179:191; Interrogation_Position=761; Antisense; AACATTTCTACCTGAATCTGCACCA
>probe:Drosophila_2:1633862_at:340:421; Interrogation_Position=789; Antisense; GAGCAGCGGGCCACAAAATGTATCC

Paste this into a BLAST search page for me
AAAGTTCTTCTCAGGTCGAGTCGAGTCACACCGTGGACTTTGAGATCAAGAGCCACCCCAGCGATTGGAGTTTGAGAGCAAAACTCTCCTCAGGGACATTGACATTTGGTTTCTTTGGGCGTCAAAGAAGCCACCTCAGCACTTGGAGGTAGAAGCCTCCACAGCACTTGGAAATGATCAAGCCTGTTGACCAGAAGCCAACCGCACCGTGTGGAGCTTGAAGTCGCTTGAAGTCCAACAGCAGCATCACGGGACACTTGGTTTCTTTGGGAGCAGAGCTTATGGTATTCCAACTGCAGAAACATTTCTACCTGAATCTGCACCAGAGCAGCGGGCCACAAAATGTATCC

Full Affymetrix probeset data:

Annotations for 1633862_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime