Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633864_at:

>probe:Drosophila_2:1633864_at:87:511; Interrogation_Position=15; Antisense; GTGCACGATGCAATTCCAAATACAA
>probe:Drosophila_2:1633864_at:418:355; Interrogation_Position=17; Antisense; GCACGATGCAATTCCAAATACAAAA
>probe:Drosophila_2:1633864_at:502:359; Interrogation_Position=24; Antisense; GCAATTCCAAATACAAAATGCGGTG
>probe:Drosophila_2:1633864_at:305:185; Interrogation_Position=38; Antisense; AAAATGCGGTGTACGCAGCTCAACT
>probe:Drosophila_2:1633864_at:227:621; Interrogation_Position=42; Antisense; TGCGGTGTACGCAGCTCAACTTGTT
>probe:Drosophila_2:1633864_at:422:289; Interrogation_Position=44; Antisense; CGGTGTACGCAGCTCAACTTGTTGT
>probe:Drosophila_2:1633864_at:205:515; Interrogation_Position=46; Antisense; GTGTACGCAGCTCAACTTGTTGTGC
>probe:Drosophila_2:1633864_at:123:673; Interrogation_Position=49; Antisense; TACGCAGCTCAACTTGTTGTGCGCT
>probe:Drosophila_2:1633864_at:476:351; Interrogation_Position=52; Antisense; GCAGCTCAACTTGTTGTGCGCTTTA
>probe:Drosophila_2:1633864_at:85:263; Interrogation_Position=53; Antisense; CAGCTCAACTTGTTGTGCGCTTTAA
>probe:Drosophila_2:1633864_at:324:339; Interrogation_Position=55; Antisense; GCTCAACTTGTTGTGCGCTTTAATT
>probe:Drosophila_2:1633864_at:599:651; Interrogation_Position=57; Antisense; TCAACTTGTTGTGCGCTTTAATTGT
>probe:Drosophila_2:1633864_at:568:149; Interrogation_Position=60; Antisense; ACTTGTTGTGCGCTTTAATTGTACT
>probe:Drosophila_2:1633864_at:99:727; Interrogation_Position=62; Antisense; TTGTTGTGCGCTTTAATTGTACTGG

Paste this into a BLAST search page for me
GTGCACGATGCAATTCCAAATACAAGCACGATGCAATTCCAAATACAAAAGCAATTCCAAATACAAAATGCGGTGAAAATGCGGTGTACGCAGCTCAACTTGCGGTGTACGCAGCTCAACTTGTTCGGTGTACGCAGCTCAACTTGTTGTGTGTACGCAGCTCAACTTGTTGTGCTACGCAGCTCAACTTGTTGTGCGCTGCAGCTCAACTTGTTGTGCGCTTTACAGCTCAACTTGTTGTGCGCTTTAAGCTCAACTTGTTGTGCGCTTTAATTTCAACTTGTTGTGCGCTTTAATTGTACTTGTTGTGCGCTTTAATTGTACTTTGTTGTGCGCTTTAATTGTACTGG

Full Affymetrix probeset data:

Annotations for 1633864_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime