FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633865_at:

>probe:Drosophila_2:1633865_at:472:341; Interrogation_Position=1028; Antisense; GCTATCTGGTTTGCATCATGCCTAT
>probe:Drosophila_2:1633865_at:316:663; Interrogation_Position=1154; Antisense; TAAAACTCGTTTCGCGGTTCATCGA
>probe:Drosophila_2:1633865_at:565:77; Interrogation_Position=1244; Antisense; AGGAGGCTCTGTCAATTGTGCACCA
>probe:Drosophila_2:1633865_at:244:453; Interrogation_Position=685; Antisense; GATCTAGATGCTTTCACGTGGAACC
>probe:Drosophila_2:1633865_at:695:49; Interrogation_Position=721; Antisense; ATGCTGGAACGCCTCATTCAGAACG
>probe:Drosophila_2:1633865_at:334:713; Interrogation_Position=737; Antisense; TTCAGAACGTGACAATGGCCTCCAG
>probe:Drosophila_2:1633865_at:700:625; Interrogation_Position=778; Antisense; TGCCTGCTGCAGTATATCATCCGAT
>probe:Drosophila_2:1633865_at:351:77; Interrogation_Position=804; Antisense; AGGATACTACTTCACCATCAATCGC
>probe:Drosophila_2:1633865_at:348:509; Interrogation_Position=835; Antisense; GTGAAAACTGCTTTGGCCATGGATA
>probe:Drosophila_2:1633865_at:327:527; Interrogation_Position=890; Antisense; GGGACGTATGCCTTGCTCTAAATGT
>probe:Drosophila_2:1633865_at:476:705; Interrogation_Position=914; Antisense; TTAGCACCAGCTATCGTTGGGCCAA
>probe:Drosophila_2:1633865_at:373:227; Interrogation_Position=937; Antisense; AAGGCCATCCTACAAATGCTTGTCC
>probe:Drosophila_2:1633865_at:644:359; Interrogation_Position=971; Antisense; GCAAGCTGCTCCAAGGTGTCGAGGT
>probe:Drosophila_2:1633865_at:498:539; Interrogation_Position=993; Antisense; GGTATGCACTGCTTTACTGGATCAA

Paste this into a BLAST search page for me
GCTATCTGGTTTGCATCATGCCTATTAAAACTCGTTTCGCGGTTCATCGAAGGAGGCTCTGTCAATTGTGCACCAGATCTAGATGCTTTCACGTGGAACCATGCTGGAACGCCTCATTCAGAACGTTCAGAACGTGACAATGGCCTCCAGTGCCTGCTGCAGTATATCATCCGATAGGATACTACTTCACCATCAATCGCGTGAAAACTGCTTTGGCCATGGATAGGGACGTATGCCTTGCTCTAAATGTTTAGCACCAGCTATCGTTGGGCCAAAAGGCCATCCTACAAATGCTTGTCCGCAAGCTGCTCCAAGGTGTCGAGGTGGTATGCACTGCTTTACTGGATCAA

Full Affymetrix probeset data:

Annotations for 1633865_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720