Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633869_at:

>probe:Drosophila_2:1633869_at:606:529; Interrogation_Position=2160; Antisense; GGGTCACACGAATCTGCATGGGCAC
>probe:Drosophila_2:1633869_at:154:619; Interrogation_Position=2174; Antisense; TGCATGGGCACCTTCAACAGCAACA
>probe:Drosophila_2:1633869_at:193:359; Interrogation_Position=2193; Antisense; GCAACAATCCGATCTCATGACCAAT
>probe:Drosophila_2:1633869_at:689:609; Interrogation_Position=2210; Antisense; TGACCAATCTTCAGCTACACATCAA
>probe:Drosophila_2:1633869_at:706:207; Interrogation_Position=2233; Antisense; AAGCAGGACTACGATCTGACGGCCC
>probe:Drosophila_2:1633869_at:663:639; Interrogation_Position=2247; Antisense; TCTGACGGCCCTGTAGAATCAGCAG
>probe:Drosophila_2:1633869_at:28:165; Interrogation_Position=2306; Antisense; AAATACCCCTATCATTCTATGTAGA
>probe:Drosophila_2:1633869_at:470:365; Interrogation_Position=2348; Antisense; GAATCAATGACCTTGAACTTCAGGC
>probe:Drosophila_2:1633869_at:641:651; Interrogation_Position=2407; Antisense; TAGTTAGTTAAGGACCGACCATTAG
>probe:Drosophila_2:1633869_at:351:673; Interrogation_Position=2429; Antisense; TAGGTAGACGACTCCCATTTTATAA
>probe:Drosophila_2:1633869_at:662:29; Interrogation_Position=2450; Antisense; ATAATGTTGTAGTCCCAATTCCCCA
>probe:Drosophila_2:1633869_at:257:311; Interrogation_Position=2462; Antisense; TCCCAATTCCCCACAAGTGTTGTAT
>probe:Drosophila_2:1633869_at:605:427; Interrogation_Position=2489; Antisense; GAGTTTTACTTAAGCACCCTAGGAT
>probe:Drosophila_2:1633869_at:232:679; Interrogation_Position=2635; Antisense; TAGTTTGCATCTGTTGTGCGTCTCT

Paste this into a BLAST search page for me
GGGTCACACGAATCTGCATGGGCACTGCATGGGCACCTTCAACAGCAACAGCAACAATCCGATCTCATGACCAATTGACCAATCTTCAGCTACACATCAAAAGCAGGACTACGATCTGACGGCCCTCTGACGGCCCTGTAGAATCAGCAGAAATACCCCTATCATTCTATGTAGAGAATCAATGACCTTGAACTTCAGGCTAGTTAGTTAAGGACCGACCATTAGTAGGTAGACGACTCCCATTTTATAAATAATGTTGTAGTCCCAATTCCCCATCCCAATTCCCCACAAGTGTTGTATGAGTTTTACTTAAGCACCCTAGGATTAGTTTGCATCTGTTGTGCGTCTCT

Full Affymetrix probeset data:

Annotations for 1633869_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime