Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633870_at:

>probe:Drosophila_2:1633870_at:569:311; Interrogation_Position=1000; Antisense; GCGCACGGTACCCTTTTCGGGAATG
>probe:Drosophila_2:1633870_at:630:309; Interrogation_Position=1029; Antisense; GCCATAAGTACTACCCGTTCAACGA
>probe:Drosophila_2:1633870_at:722:711; Interrogation_Position=1046; Antisense; TTCAACGACGAGTTCTAGACGGGCT
>probe:Drosophila_2:1633870_at:330:395; Interrogation_Position=1084; Antisense; GAAATATCGGTTTCGCCGTTATTGG
>probe:Drosophila_2:1633870_at:575:479; Interrogation_Position=1190; Antisense; GTTTCGAGTAAACCCGTGCATTAAT
>probe:Drosophila_2:1633870_at:221:213; Interrogation_Position=1235; Antisense; AAGAGGTTCGTAAGACACCCCGCAT
>probe:Drosophila_2:1633870_at:145:399; Interrogation_Position=1248; Antisense; GACACCCCGCATATGTAGTATTTGT
>probe:Drosophila_2:1633870_at:271:49; Interrogation_Position=717; Antisense; ATGCCAAGCGCCACGGACTGGTCAT
>probe:Drosophila_2:1633870_at:431:97; Interrogation_Position=852; Antisense; AGATCTGCCTGCGTTATCTGGTCCA
>probe:Drosophila_2:1633870_at:329:41; Interrogation_Position=867; Antisense; ATCTGGTCCAGCTAGGCGTGGTGCC
>probe:Drosophila_2:1633870_at:428:219; Interrogation_Position=899; Antisense; AAGTCGTCGAACAAGGCCCGCATCG
>probe:Drosophila_2:1633870_at:591:149; Interrogation_Position=945; Antisense; ACTTCGAGCTGAGTCCAGACGACGT
>probe:Drosophila_2:1633870_at:185:407; Interrogation_Position=965; Antisense; GACGTCGCCGGCATGGAGCAGTATC
>probe:Drosophila_2:1633870_at:111:67; Interrogation_Position=977; Antisense; ATGGAGCAGTATCACACCGGGCAGC

Paste this into a BLAST search page for me
GCGCACGGTACCCTTTTCGGGAATGGCCATAAGTACTACCCGTTCAACGATTCAACGACGAGTTCTAGACGGGCTGAAATATCGGTTTCGCCGTTATTGGGTTTCGAGTAAACCCGTGCATTAATAAGAGGTTCGTAAGACACCCCGCATGACACCCCGCATATGTAGTATTTGTATGCCAAGCGCCACGGACTGGTCATAGATCTGCCTGCGTTATCTGGTCCAATCTGGTCCAGCTAGGCGTGGTGCCAAGTCGTCGAACAAGGCCCGCATCGACTTCGAGCTGAGTCCAGACGACGTGACGTCGCCGGCATGGAGCAGTATCATGGAGCAGTATCACACCGGGCAGC

Full Affymetrix probeset data:

Annotations for 1633870_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime