Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633872_at:

>probe:Drosophila_2:1633872_at:528:79; Interrogation_Position=167; Antisense; AGGTGGAATTGTTTCCCGACACCAT
>probe:Drosophila_2:1633872_at:588:185; Interrogation_Position=199; Antisense; AACACGCGGATTATTGTCTACAAGA
>probe:Drosophila_2:1633872_at:561:665; Interrogation_Position=217; Antisense; TACAAGAACACTGTCGTCGAGTCGC
>probe:Drosophila_2:1633872_at:551:451; Interrogation_Position=247; Antisense; GATCTGTCCCAGACGGCAATGGATG
>probe:Drosophila_2:1633872_at:118:725; Interrogation_Position=281; Antisense; TTGTGTGGTATGTGGCCACTTTCCT
>probe:Drosophila_2:1633872_at:181:53; Interrogation_Position=325; Antisense; ATGCTGATGGCCTGTTCGGATCGCA
>probe:Drosophila_2:1633872_at:608:549; Interrogation_Position=379; Antisense; GGAGGTCAATCCACCGAGGGTCTGA
>probe:Drosophila_2:1633872_at:717:631; Interrogation_Position=447; Antisense; TCCCAGCTACGATACGGTGATCAAG
>probe:Drosophila_2:1633872_at:565:605; Interrogation_Position=464; Antisense; TGATCAAGATGCAGCACGCGGCCAA
>probe:Drosophila_2:1633872_at:435:375; Interrogation_Position=48; Antisense; GAAGATCCATTCCTCGTGCTGCGTA
>probe:Drosophila_2:1633872_at:61:123; Interrogation_Position=493; Antisense; AGCGTGTTTGTGATACCGTTCAGCA
>probe:Drosophila_2:1633872_at:462:349; Interrogation_Position=586; Antisense; GCAGTCACCTGCGATGTGATCATCG
>probe:Drosophila_2:1633872_at:164:509; Interrogation_Position=63; Antisense; GTGCTGCGTAGACGGCCAGTCCTAT
>probe:Drosophila_2:1633872_at:346:87; Interrogation_Position=80; Antisense; AGTCCTATCTCTTCAGCGTGGAGAA

Paste this into a BLAST search page for me
AGGTGGAATTGTTTCCCGACACCATAACACGCGGATTATTGTCTACAAGATACAAGAACACTGTCGTCGAGTCGCGATCTGTCCCAGACGGCAATGGATGTTGTGTGGTATGTGGCCACTTTCCTATGCTGATGGCCTGTTCGGATCGCAGGAGGTCAATCCACCGAGGGTCTGATCCCAGCTACGATACGGTGATCAAGTGATCAAGATGCAGCACGCGGCCAAGAAGATCCATTCCTCGTGCTGCGTAAGCGTGTTTGTGATACCGTTCAGCAGCAGTCACCTGCGATGTGATCATCGGTGCTGCGTAGACGGCCAGTCCTATAGTCCTATCTCTTCAGCGTGGAGAA

Full Affymetrix probeset data:

Annotations for 1633872_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime