FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633874_at:

>probe:Drosophila_2:1633874_at:483:395; Interrogation_Position=388; Antisense; GAAATCAAGGTGGACCAGAATATCA
>probe:Drosophila_2:1633874_at:56:81; Interrogation_Position=395; Antisense; AGGTGGACCAGAATATCAAGGAGGT
>probe:Drosophila_2:1633874_at:496:1; Interrogation_Position=463; Antisense; ATTAGGGAAATGATCCAGGATTCAG
>probe:Drosophila_2:1633874_at:391:391; Interrogation_Position=559; Antisense; GAAACCGTAGTGGTCCACGCCTTGC
>probe:Drosophila_2:1633874_at:586:83; Interrogation_Position=567; Antisense; AGTGGTCCACGCCTTGCGAAGCATT
>probe:Drosophila_2:1633874_at:461:125; Interrogation_Position=575; Antisense; ACGCCTTGCGAAGCATTTCTGGGCC
>probe:Drosophila_2:1633874_at:235:663; Interrogation_Position=606; Antisense; TAAACCACCTTTAAACTATCATCCT
>probe:Drosophila_2:1633874_at:200:663; Interrogation_Position=617; Antisense; TAAACTATCATCCTAATGCCGAGAA
>probe:Drosophila_2:1633874_at:449:43; Interrogation_Position=663; Antisense; ATCGATGCGAATGGTGAGAAATCTC
>probe:Drosophila_2:1633874_at:488:229; Interrogation_Position=672; Antisense; AATGGTGAGAAATCTCACACCGTTC
>probe:Drosophila_2:1633874_at:155:291; Interrogation_Position=884; Antisense; CGTGTCTGGTCGATCCGATGTCTGA
>probe:Drosophila_2:1633874_at:641:591; Interrogation_Position=890; Antisense; TGGTCGATCCGATGTCTGATCCGAT
>probe:Drosophila_2:1633874_at:473:449; Interrogation_Position=895; Antisense; GATCCGATGTCTGATCCGATCAAAA
>probe:Drosophila_2:1633874_at:211:285; Interrogation_Position=905; Antisense; CTGATCCGATCAAAATGCCAACACC

Paste this into a BLAST search page for me
GAAATCAAGGTGGACCAGAATATCAAGGTGGACCAGAATATCAAGGAGGTATTAGGGAAATGATCCAGGATTCAGGAAACCGTAGTGGTCCACGCCTTGCAGTGGTCCACGCCTTGCGAAGCATTACGCCTTGCGAAGCATTTCTGGGCCTAAACCACCTTTAAACTATCATCCTTAAACTATCATCCTAATGCCGAGAAATCGATGCGAATGGTGAGAAATCTCAATGGTGAGAAATCTCACACCGTTCCGTGTCTGGTCGATCCGATGTCTGATGGTCGATCCGATGTCTGATCCGATGATCCGATGTCTGATCCGATCAAAACTGATCCGATCAAAATGCCAACACC

Full Affymetrix probeset data:

Annotations for 1633874_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720