FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633876_at:

>probe:Drosophila_2:1633876_at:661:203; Interrogation_Position=2504; Antisense; AAGCGTTGGGAAGCGTTCCTGCAGT
>probe:Drosophila_2:1633876_at:117:469; Interrogation_Position=2518; Antisense; GTTCCTGCAGTGCAAAAGTTCACCG
>probe:Drosophila_2:1633876_at:436:217; Interrogation_Position=2533; Antisense; AAGTTCACCGTTTCAACATCATCGC
>probe:Drosophila_2:1633876_at:481:21; Interrogation_Position=2550; Antisense; ATCATCGCCTAAAATCCTAACTCAA
>probe:Drosophila_2:1633876_at:453:233; Interrogation_Position=2562; Antisense; AATCCTAACTCAAGTGGGAGCCATA
>probe:Drosophila_2:1633876_at:133:349; Interrogation_Position=2598; Antisense; GCAGGCAGCACGATTCTTTGACGAT
>probe:Drosophila_2:1633876_at:130:409; Interrogation_Position=2617; Antisense; GACGATGAAGTTGATCCGGATGATT
>probe:Drosophila_2:1633876_at:722:531; Interrogation_Position=2650; Antisense; GGTGTCAACCACTCGTTTTCAGAAT
>probe:Drosophila_2:1633876_at:596:587; Interrogation_Position=2687; Antisense; TGGATTGACAGCTCTTTTAAACCGA
>probe:Drosophila_2:1633876_at:108:693; Interrogation_Position=2732; Antisense; TTTGATGTCTTCACATTTGCCATTA
>probe:Drosophila_2:1633876_at:361:19; Interrogation_Position=2746; Antisense; ATTTGCCATTATTATTTCACACTTA
>probe:Drosophila_2:1633876_at:177:679; Interrogation_Position=2808; Antisense; TAGTGAGCTGGTTCCAAGTGCTTCG
>probe:Drosophila_2:1633876_at:71:221; Interrogation_Position=2823; Antisense; AAGTGCTTCGGCTGTTTCATTCAGC
>probe:Drosophila_2:1633876_at:370:13; Interrogation_Position=2841; Antisense; ATTCAGCGACTCTAATACATAAGGC

Paste this into a BLAST search page for me
AAGCGTTGGGAAGCGTTCCTGCAGTGTTCCTGCAGTGCAAAAGTTCACCGAAGTTCACCGTTTCAACATCATCGCATCATCGCCTAAAATCCTAACTCAAAATCCTAACTCAAGTGGGAGCCATAGCAGGCAGCACGATTCTTTGACGATGACGATGAAGTTGATCCGGATGATTGGTGTCAACCACTCGTTTTCAGAATTGGATTGACAGCTCTTTTAAACCGATTTGATGTCTTCACATTTGCCATTAATTTGCCATTATTATTTCACACTTATAGTGAGCTGGTTCCAAGTGCTTCGAAGTGCTTCGGCTGTTTCATTCAGCATTCAGCGACTCTAATACATAAGGC

Full Affymetrix probeset data:

Annotations for 1633876_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720