FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633878_at:

>probe:Drosophila_2:1633878_at:10:473; Interrogation_Position=6102; Antisense; GTTCGGTGCAGGAGGATCTCGCCCA
>probe:Drosophila_2:1633878_at:111:411; Interrogation_Position=6174; Antisense; GACCCTGAAAATTCGGCCTAGCCTG
>probe:Drosophila_2:1633878_at:560:335; Interrogation_Position=6211; Antisense; GCTCCACCGTCGGATAGCAGTGAAA
>probe:Drosophila_2:1633878_at:152:63; Interrogation_Position=6266; Antisense; ATGTGACCAGTGTGGTACCGACTCC
>probe:Drosophila_2:1633878_at:544:9; Interrogation_Position=6417; Antisense; ATTCGCCACACTGCAGTACTTCAAG
>probe:Drosophila_2:1633878_at:51:3; Interrogation_Position=6439; Antisense; AAGGCGAACAACATACGGTATCCCA
>probe:Drosophila_2:1633878_at:529:123; Interrogation_Position=6480; Antisense; AGCGCGTCTCGCTCGTGAAGGAGAA
>probe:Drosophila_2:1633878_at:192:553; Interrogation_Position=6499; Antisense; GGAGAATCCGTGTACTGCTACTGTC
>probe:Drosophila_2:1633878_at:247:597; Interrogation_Position=6526; Antisense; TGTCCGTACGACGAGGTCTCCGAGA
>probe:Drosophila_2:1633878_at:407:537; Interrogation_Position=6540; Antisense; GGTCTCCGAGATGATCGCATGCGAC
>probe:Drosophila_2:1633878_at:357:193; Interrogation_Position=6571; Antisense; AACTGTCTGATCGAGTGGTTCCACT
>probe:Drosophila_2:1633878_at:132:719; Interrogation_Position=6589; Antisense; TTCCACTTCGAGTGCGTGGGCATTA
>probe:Drosophila_2:1633878_at:367:167; Interrogation_Position=6631; Antisense; AAATGGTTCTGTGCCGAGTGCAGGC
>probe:Drosophila_2:1633878_at:108:509; Interrogation_Position=6648; Antisense; GTGCAGGCCCAAGTACTCTGAGGGT

Paste this into a BLAST search page for me
GTTCGGTGCAGGAGGATCTCGCCCAGACCCTGAAAATTCGGCCTAGCCTGGCTCCACCGTCGGATAGCAGTGAAAATGTGACCAGTGTGGTACCGACTCCATTCGCCACACTGCAGTACTTCAAGAAGGCGAACAACATACGGTATCCCAAGCGCGTCTCGCTCGTGAAGGAGAAGGAGAATCCGTGTACTGCTACTGTCTGTCCGTACGACGAGGTCTCCGAGAGGTCTCCGAGATGATCGCATGCGACAACTGTCTGATCGAGTGGTTCCACTTTCCACTTCGAGTGCGTGGGCATTAAAATGGTTCTGTGCCGAGTGCAGGCGTGCAGGCCCAAGTACTCTGAGGGT

Full Affymetrix probeset data:

Annotations for 1633878_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720