FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633881_at:

>probe:Drosophila_2:1633881_at:34:129; Interrogation_Position=1524; Antisense; ACCTTAAGAACTTCATCGTGCGCTG
>probe:Drosophila_2:1633881_at:522:593; Interrogation_Position=1547; Antisense; TGGGAGACGCATCCGAACAGTCCGT
>probe:Drosophila_2:1633881_at:419:63; Interrogation_Position=1563; Antisense; ACAGTCCGTACGTGTTCGACGTGGA
>probe:Drosophila_2:1633881_at:6:231; Interrogation_Position=1592; Antisense; AATGTGATTGCTCCGCTGAGCGAGA
>probe:Drosophila_2:1633881_at:328:435; Interrogation_Position=1671; Antisense; GAGGTGAGTACGGATCCCAGCGACA
>probe:Drosophila_2:1633881_at:166:567; Interrogation_Position=1721; Antisense; GGCAAATGAGGCATCCGCATCGCAT
>probe:Drosophila_2:1633881_at:116:347; Interrogation_Position=1759; Antisense; GCATCCTGCAATCGGATCGACTTTG
>probe:Drosophila_2:1633881_at:706:595; Interrogation_Position=1832; Antisense; TGTGGACCAAGCTGGCTAGCTGACT
>probe:Drosophila_2:1633881_at:442:483; Interrogation_Position=1865; Antisense; GTATCTTCTATCTTTCTTTGTCTCT
>probe:Drosophila_2:1633881_at:460:365; Interrogation_Position=1913; Antisense; GAATCAATCCTTGTCTTCGGACGAG
>probe:Drosophila_2:1633881_at:501:529; Interrogation_Position=1937; Antisense; GGGAGGACCAGCTTGCCAGACAGAA
>probe:Drosophila_2:1633881_at:1:25; Interrogation_Position=1998; Antisense; ATATGCCTGGCATCCTTGTAGCGGA
>probe:Drosophila_2:1633881_at:206:727; Interrogation_Position=2013; Antisense; TTGTAGCGGATGACCAGCCCTATTA
>probe:Drosophila_2:1633881_at:265:125; Interrogation_Position=2028; Antisense; AGCCCTATTAACCACTTTACACTGT

Paste this into a BLAST search page for me
ACCTTAAGAACTTCATCGTGCGCTGTGGGAGACGCATCCGAACAGTCCGTACAGTCCGTACGTGTTCGACGTGGAAATGTGATTGCTCCGCTGAGCGAGAGAGGTGAGTACGGATCCCAGCGACAGGCAAATGAGGCATCCGCATCGCATGCATCCTGCAATCGGATCGACTTTGTGTGGACCAAGCTGGCTAGCTGACTGTATCTTCTATCTTTCTTTGTCTCTGAATCAATCCTTGTCTTCGGACGAGGGGAGGACCAGCTTGCCAGACAGAAATATGCCTGGCATCCTTGTAGCGGATTGTAGCGGATGACCAGCCCTATTAAGCCCTATTAACCACTTTACACTGT

Full Affymetrix probeset data:

Annotations for 1633881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720