Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633883_at:

>probe:Drosophila_2:1633883_at:218:413; Interrogation_Position=1020; Antisense; GAGTTACTCGTACCTCAGGAATCTA
>probe:Drosophila_2:1633883_at:223:73; Interrogation_Position=1036; Antisense; AGGAATCTACGCCAGCACATGCTCA
>probe:Drosophila_2:1633883_at:508:479; Interrogation_Position=1079; Antisense; GTTTCGAGTGCCAGGCCTTGGACTG
>probe:Drosophila_2:1633883_at:362:303; Interrogation_Position=1107; Antisense; CCGCTGTTTCAGCAGTGCGCAGAAT
>probe:Drosophila_2:1633883_at:360:367; Interrogation_Position=1128; Antisense; GAATCTGGCGAGACATCTGCTCAGG
>probe:Drosophila_2:1633883_at:567:179; Interrogation_Position=1228; Antisense; AAAACTAAGTCCACATCCCGCAAGC
>probe:Drosophila_2:1633883_at:126:205; Interrogation_Position=1249; Antisense; AAGCGACGACGCGATGCTGGACGCA
>probe:Drosophila_2:1633883_at:48:557; Interrogation_Position=1267; Antisense; GGACGCAGCAAACATTCGAGGCTAT
>probe:Drosophila_2:1633883_at:262:197; Interrogation_Position=1295; Antisense; AACTGGCCTGCCTGCAATTGGACAA
>probe:Drosophila_2:1633883_at:190:399; Interrogation_Position=1346; Antisense; GACAGCCTTTGGTCCTCGAAAAGAT
>probe:Drosophila_2:1633883_at:621:171; Interrogation_Position=1365; Antisense; AAAGATCACCCAGTCGCTGAAGGAT
>probe:Drosophila_2:1633883_at:501:77; Interrogation_Position=1385; Antisense; AGGATGACCCCGTCGAGGAGCTGCT
>probe:Drosophila_2:1633883_at:172:621; Interrogation_Position=1406; Antisense; TGCTGGCACAGACCCTGCAGGATGA
>probe:Drosophila_2:1633883_at:667:371; Interrogation_Position=1484; Antisense; GAAGGTCTGGTCAAGAGGCTAACAA

Paste this into a BLAST search page for me
GAGTTACTCGTACCTCAGGAATCTAAGGAATCTACGCCAGCACATGCTCAGTTTCGAGTGCCAGGCCTTGGACTGCCGCTGTTTCAGCAGTGCGCAGAATGAATCTGGCGAGACATCTGCTCAGGAAAACTAAGTCCACATCCCGCAAGCAAGCGACGACGCGATGCTGGACGCAGGACGCAGCAAACATTCGAGGCTATAACTGGCCTGCCTGCAATTGGACAAGACAGCCTTTGGTCCTCGAAAAGATAAAGATCACCCAGTCGCTGAAGGATAGGATGACCCCGTCGAGGAGCTGCTTGCTGGCACAGACCCTGCAGGATGAGAAGGTCTGGTCAAGAGGCTAACAA

Full Affymetrix probeset data:

Annotations for 1633883_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime