FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633884_at:

>probe:Drosophila_2:1633884_at:556:137; Interrogation_Position=1956; Antisense; ACGAGCTGGAGAACCGAGCCTCTGA
>probe:Drosophila_2:1633884_at:365:183; Interrogation_Position=1988; Antisense; AAAAGAAGATCCCATACCCTCAATC
>probe:Drosophila_2:1633884_at:559:185; Interrogation_Position=2093; Antisense; AACAAAGGCCTCAAGATCTCGGATC
>probe:Drosophila_2:1633884_at:182:89; Interrogation_Position=2176; Antisense; AGATGACATGCAACTGGCACCACTG
>probe:Drosophila_2:1633884_at:618:71; Interrogation_Position=2249; Antisense; AGTGCAAGCGTCAGGTCCACGGACT
>probe:Drosophila_2:1633884_at:326:499; Interrogation_Position=2286; Antisense; GTCTCTACTCACTGCATGACTTTGA
>probe:Drosophila_2:1633884_at:363:401; Interrogation_Position=2309; Antisense; GACATTGACCTAGATGTTCCGCTAC
>probe:Drosophila_2:1633884_at:111:55; Interrogation_Position=2322; Antisense; ATGTTCCGCTACCAGTCAATACGAA
>probe:Drosophila_2:1633884_at:695:493; Interrogation_Position=2336; Antisense; GTCAATACGAATTCAGTGCCCAAGC
>probe:Drosophila_2:1633884_at:106:205; Interrogation_Position=2357; Antisense; AAGCCGGCTAGCAAACCAGCTGAAA
>probe:Drosophila_2:1633884_at:109:89; Interrogation_Position=2383; Antisense; AGTCTCCAAACGTTCGCTGAATCTA
>probe:Drosophila_2:1633884_at:204:547; Interrogation_Position=2445; Antisense; GGATGCCGCTGGTCATACATATACT
>probe:Drosophila_2:1633884_at:25:175; Interrogation_Position=2473; Antisense; AAAGCGTCGCATGTTTACGTCCTAG
>probe:Drosophila_2:1633884_at:485:499; Interrogation_Position=2491; Antisense; GTCCTAGTTTAGTGTAGTGCCCAAA

Paste this into a BLAST search page for me
ACGAGCTGGAGAACCGAGCCTCTGAAAAAGAAGATCCCATACCCTCAATCAACAAAGGCCTCAAGATCTCGGATCAGATGACATGCAACTGGCACCACTGAGTGCAAGCGTCAGGTCCACGGACTGTCTCTACTCACTGCATGACTTTGAGACATTGACCTAGATGTTCCGCTACATGTTCCGCTACCAGTCAATACGAAGTCAATACGAATTCAGTGCCCAAGCAAGCCGGCTAGCAAACCAGCTGAAAAGTCTCCAAACGTTCGCTGAATCTAGGATGCCGCTGGTCATACATATACTAAAGCGTCGCATGTTTACGTCCTAGGTCCTAGTTTAGTGTAGTGCCCAAA

Full Affymetrix probeset data:

Annotations for 1633884_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720