FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633886_at:

>probe:Drosophila_2:1633886_at:453:505; Interrogation_Position=100; Antisense; GTGCCCGATCCATTTGACAAACGAG
>probe:Drosophila_2:1633886_at:160:13; Interrogation_Position=148; Antisense; ATTAATGACCCGGAACATCCTTTGA
>probe:Drosophila_2:1633886_at:634:559; Interrogation_Position=159; Antisense; GGAACATCCTTTGACCCTGGAGGAG
>probe:Drosophila_2:1633886_at:568:27; Interrogation_Position=221; Antisense; ATAGCCAGAATTCCGTGCACATCAG
>probe:Drosophila_2:1633886_at:463:719; Interrogation_Position=267; Antisense; TTGCTCGATGGCCACTTTGATTGGC
>probe:Drosophila_2:1633886_at:571:603; Interrogation_Position=284; Antisense; TGATTGGCCTCTCCATCCGGGTGAA
>probe:Drosophila_2:1633886_at:530:385; Interrogation_Position=30; Antisense; GAACATCAACCCCAATGTCTACGAC
>probe:Drosophila_2:1633886_at:119:261; Interrogation_Position=326; Antisense; CACCTCGCTTTAAGGTCACCGTGGA
>probe:Drosophila_2:1633886_at:626:493; Interrogation_Position=340; Antisense; GTCACCGTGGAAATAACGCCCGGCA
>probe:Drosophila_2:1633886_at:604:133; Interrogation_Position=368; Antisense; ACGCCTCCGAGCTGGCGGTGAACAA
>probe:Drosophila_2:1633886_at:228:53; Interrogation_Position=402; Antisense; AGACAAGGAACGAGTGGCCGCCGCC
>probe:Drosophila_2:1633886_at:245:587; Interrogation_Position=428; Antisense; TGGAGAACAATCACCTCGCCGAGGT
>probe:Drosophila_2:1633886_at:391:435; Interrogation_Position=448; Antisense; GAGGTGATCAACCAGTGCATCGCCG
>probe:Drosophila_2:1633886_at:634:371; Interrogation_Position=88; Antisense; GAAGACGAAAACGTGCCCGATCCAT

Paste this into a BLAST search page for me
GTGCCCGATCCATTTGACAAACGAGATTAATGACCCGGAACATCCTTTGAGGAACATCCTTTGACCCTGGAGGAGATAGCCAGAATTCCGTGCACATCAGTTGCTCGATGGCCACTTTGATTGGCTGATTGGCCTCTCCATCCGGGTGAAGAACATCAACCCCAATGTCTACGACCACCTCGCTTTAAGGTCACCGTGGAGTCACCGTGGAAATAACGCCCGGCAACGCCTCCGAGCTGGCGGTGAACAAAGACAAGGAACGAGTGGCCGCCGCCTGGAGAACAATCACCTCGCCGAGGTGAGGTGATCAACCAGTGCATCGCCGGAAGACGAAAACGTGCCCGATCCAT

Full Affymetrix probeset data:

Annotations for 1633886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720