FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633887_at:

>probe:Drosophila_2:1633887_at:722:581; Interrogation_Position=465; Antisense; TGGCGCCAGCAACGATCTCGAGGAT
>probe:Drosophila_2:1633887_at:88:443; Interrogation_Position=487; Antisense; GATGTGGTGATGTCACGAGCCTCCG
>probe:Drosophila_2:1633887_at:96:245; Interrogation_Position=553; Antisense; AATTCGCCCATCTACTACGTAAGAC
>probe:Drosophila_2:1633887_at:625:305; Interrogation_Position=584; Antisense; CCACACCGTATATGTTTTTGCCCAA
>probe:Drosophila_2:1633887_at:672:477; Interrogation_Position=597; Antisense; GTTTTTGCCCAATATGCCAACGGCT
>probe:Drosophila_2:1633887_at:305:633; Interrogation_Position=676; Antisense; TCCGCCTACGGTTCGGTATTCAATT
>probe:Drosophila_2:1633887_at:103:709; Interrogation_Position=694; Antisense; TTCAATTTGCCCGTGAACTTCCTGG
>probe:Drosophila_2:1633887_at:238:559; Interrogation_Position=724; Antisense; GGAAAGCCCACTGGAGTCTACCAAG
>probe:Drosophila_2:1633887_at:173:499; Interrogation_Position=739; Antisense; GTCTACCAAGTGAACGGATCTCCGG
>probe:Drosophila_2:1633887_at:266:679; Interrogation_Position=831; Antisense; TAGTAATCCCTACAGACCCATGTCG
>probe:Drosophila_2:1633887_at:155:75; Interrogation_Position=926; Antisense; AGGACTCCAAGCTGACATCGCTGAA
>probe:Drosophila_2:1633887_at:3:333; Interrogation_Position=945; Antisense; GCTGAAGCGTCCGTTCGTGTTCAAC
>probe:Drosophila_2:1633887_at:118:515; Interrogation_Position=961; Antisense; GTGTTCAACGGTCGTCCCGAGGACA
>probe:Drosophila_2:1633887_at:493:255; Interrogation_Position=998; Antisense; CAAACAACTTGGGTCCGCTCTACAA

Paste this into a BLAST search page for me
TGGCGCCAGCAACGATCTCGAGGATGATGTGGTGATGTCACGAGCCTCCGAATTCGCCCATCTACTACGTAAGACCCACACCGTATATGTTTTTGCCCAAGTTTTTGCCCAATATGCCAACGGCTTCCGCCTACGGTTCGGTATTCAATTTTCAATTTGCCCGTGAACTTCCTGGGGAAAGCCCACTGGAGTCTACCAAGGTCTACCAAGTGAACGGATCTCCGGTAGTAATCCCTACAGACCCATGTCGAGGACTCCAAGCTGACATCGCTGAAGCTGAAGCGTCCGTTCGTGTTCAACGTGTTCAACGGTCGTCCCGAGGACACAAACAACTTGGGTCCGCTCTACAA

Full Affymetrix probeset data:

Annotations for 1633887_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720