FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633890_at:

>probe:Drosophila_2:1633890_at:61:245; Interrogation_Position=5670; Antisense; AATTAAGTTGTACGCGATCACAGGA
>probe:Drosophila_2:1633890_at:65:339; Interrogation_Position=5746; Antisense; GCTAGCTTAGCTAACATGCCGAATG
>probe:Drosophila_2:1633890_at:466:229; Interrogation_Position=5778; Antisense; AATGGATTCAGCGAACATGCAAGTA
>probe:Drosophila_2:1633890_at:687:715; Interrogation_Position=5809; Antisense; TTCGGTGAAACGACGATACTTCTAT
>probe:Drosophila_2:1633890_at:54:457; Interrogation_Position=5823; Antisense; GATACTTCTATCGATACTCTTTACA
>probe:Drosophila_2:1633890_at:124:147; Interrogation_Position=5838; Antisense; ACTCTTTACATATTTAGGCTTAGCT
>probe:Drosophila_2:1633890_at:565:71; Interrogation_Position=5853; Antisense; AGGCTTAGCTGATTTTCTCTCGAAC
>probe:Drosophila_2:1633890_at:463:459; Interrogation_Position=5888; Antisense; GATATACCACTTTTGATTGGCATGG
>probe:Drosophila_2:1633890_at:21:701; Interrogation_Position=5924; Antisense; TTTTAAGGCTATCAGCCACTTTAAA
>probe:Drosophila_2:1633890_at:528:395; Interrogation_Position=5953; Antisense; GACAAAACGAAGAGCACCCAAAATT
>probe:Drosophila_2:1633890_at:726:599; Interrogation_Position=6093; Antisense; TGTTTAACCTTCAACTTACGCTTAT
>probe:Drosophila_2:1633890_at:226:691; Interrogation_Position=6127; Antisense; TTTGAGAACCCGTTTGAGATCTGTT
>probe:Drosophila_2:1633890_at:287:427; Interrogation_Position=6142; Antisense; GAGATCTGTTCAAAACTGCAAGTAA
>probe:Drosophila_2:1633890_at:673:139; Interrogation_Position=6230; Antisense; ACGTGCAGACACAAACCAATCTAAA

Paste this into a BLAST search page for me
AATTAAGTTGTACGCGATCACAGGAGCTAGCTTAGCTAACATGCCGAATGAATGGATTCAGCGAACATGCAAGTATTCGGTGAAACGACGATACTTCTATGATACTTCTATCGATACTCTTTACAACTCTTTACATATTTAGGCTTAGCTAGGCTTAGCTGATTTTCTCTCGAACGATATACCACTTTTGATTGGCATGGTTTTAAGGCTATCAGCCACTTTAAAGACAAAACGAAGAGCACCCAAAATTTGTTTAACCTTCAACTTACGCTTATTTTGAGAACCCGTTTGAGATCTGTTGAGATCTGTTCAAAACTGCAAGTAAACGTGCAGACACAAACCAATCTAAA

Full Affymetrix probeset data:

Annotations for 1633890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720