Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633891_at:

>probe:Drosophila_2:1633891_at:29:575; Interrogation_Position=2530; Antisense; GGCGGTGCGGAGTCTGCCACACACA
>probe:Drosophila_2:1633891_at:181:89; Interrogation_Position=2558; Antisense; AGTACAGCAGCCTCAACACGGTAAT
>probe:Drosophila_2:1633891_at:424:537; Interrogation_Position=2577; Antisense; GGTAATCAGCATGGGTCGGTCCACG
>probe:Drosophila_2:1633891_at:354:287; Interrogation_Position=2632; Antisense; CTGGCCGCCCGGATGGACAATAATG
>probe:Drosophila_2:1633891_at:199:657; Interrogation_Position=2652; Antisense; TAATGCCACCACTCAAGTCACACAG
>probe:Drosophila_2:1633891_at:530:199; Interrogation_Position=2694; Antisense; AACGAACGCTATCCGGCTGGTGCAC
>probe:Drosophila_2:1633891_at:340:655; Interrogation_Position=2835; Antisense; TAATGTTCCCACCAGCGGTATCAGT
>probe:Drosophila_2:1633891_at:326:433; Interrogation_Position=2862; Antisense; GAGTGCCGCCAATCTGAGCTGCGAA
>probe:Drosophila_2:1633891_at:27:551; Interrogation_Position=2890; Antisense; GGAGTCACTGCATCAACCACAACGA
>probe:Drosophila_2:1633891_at:288:199; Interrogation_Position=2919; Antisense; AACGCCCGCCGTTATGCTAGAGCTT
>probe:Drosophila_2:1633891_at:620:111; Interrogation_Position=2987; Antisense; AGCATCGGGCCCACTTGATACGGGA
>probe:Drosophila_2:1633891_at:594:725; Interrogation_Position=3022; Antisense; TTGGACGGCGAAAAGCGCGATCCCA
>probe:Drosophila_2:1633891_at:577:625; Interrogation_Position=3050; Antisense; TGCCCGGCACTTCCAGAAAATGGTC
>probe:Drosophila_2:1633891_at:593:225; Interrogation_Position=3068; Antisense; AATGGTCCAAGGAGACACTCTTCTA

Paste this into a BLAST search page for me
GGCGGTGCGGAGTCTGCCACACACAAGTACAGCAGCCTCAACACGGTAATGGTAATCAGCATGGGTCGGTCCACGCTGGCCGCCCGGATGGACAATAATGTAATGCCACCACTCAAGTCACACAGAACGAACGCTATCCGGCTGGTGCACTAATGTTCCCACCAGCGGTATCAGTGAGTGCCGCCAATCTGAGCTGCGAAGGAGTCACTGCATCAACCACAACGAAACGCCCGCCGTTATGCTAGAGCTTAGCATCGGGCCCACTTGATACGGGATTGGACGGCGAAAAGCGCGATCCCATGCCCGGCACTTCCAGAAAATGGTCAATGGTCCAAGGAGACACTCTTCTA

Full Affymetrix probeset data:

Annotations for 1633891_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime