FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633893_at:

>probe:Drosophila_2:1633893_at:36:717; Interrogation_Position=1807; Antisense; TTCGCTGGCTGGAACATCGAGAACA
>probe:Drosophila_2:1633893_at:544:379; Interrogation_Position=1837; Antisense; GAACTCCAGTTTGTGCCGGCCGTGT
>probe:Drosophila_2:1633893_at:143:505; Interrogation_Position=1860; Antisense; GTCCAAGTCGAATTCCGTGTGCCGT
>probe:Drosophila_2:1633893_at:678:37; Interrogation_Position=1889; Antisense; ATCTGCGGGACATCCAGGCGGACAA
>probe:Drosophila_2:1633893_at:235:71; Interrogation_Position=1904; Antisense; AGGCGGACAAGTTCTGCATCTTCAC
>probe:Drosophila_2:1633893_at:711:345; Interrogation_Position=1919; Antisense; GCATCTTCACGCAGGGCAAGTCGCT
>probe:Drosophila_2:1633893_at:256:233; Interrogation_Position=2056; Antisense; AATGCAGATCAGTGTGCCCACAGCC
>probe:Drosophila_2:1633893_at:634:155; Interrogation_Position=2075; Antisense; ACAGCCTGACCGTGATGACCAACAT
>probe:Drosophila_2:1633893_at:723:609; Interrogation_Position=2090; Antisense; TGACCAACATCCAGCACTTCGAGGA
>probe:Drosophila_2:1633893_at:184:389; Interrogation_Position=2146; Antisense; GAAACTAGGTCCTGAGTCCGGGCAC
>probe:Drosophila_2:1633893_at:20:433; Interrogation_Position=2159; Antisense; GAGTCCGGGCACTTATTGTGATTAC
>probe:Drosophila_2:1633893_at:63:219; Interrogation_Position=2212; Antisense; AAGTCGTCAAACCTATTTTCTATCG
>probe:Drosophila_2:1633893_at:14:723; Interrogation_Position=2312; Antisense; TTGCCAATTGCCACACTAAGCTATT
>probe:Drosophila_2:1633893_at:152:689; Interrogation_Position=2333; Antisense; TATTTACCCTCTAATCCTCAACATT

Paste this into a BLAST search page for me
TTCGCTGGCTGGAACATCGAGAACAGAACTCCAGTTTGTGCCGGCCGTGTGTCCAAGTCGAATTCCGTGTGCCGTATCTGCGGGACATCCAGGCGGACAAAGGCGGACAAGTTCTGCATCTTCACGCATCTTCACGCAGGGCAAGTCGCTAATGCAGATCAGTGTGCCCACAGCCACAGCCTGACCGTGATGACCAACATTGACCAACATCCAGCACTTCGAGGAGAAACTAGGTCCTGAGTCCGGGCACGAGTCCGGGCACTTATTGTGATTACAAGTCGTCAAACCTATTTTCTATCGTTGCCAATTGCCACACTAAGCTATTTATTTACCCTCTAATCCTCAACATT

Full Affymetrix probeset data:

Annotations for 1633893_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720