FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633895_at:

>probe:Drosophila_2:1633895_at:709:373; Interrogation_Position=1168; Antisense; GAAGTACATCACCAAGCCAGATCGC
>probe:Drosophila_2:1633895_at:308:207; Interrogation_Position=1196; Antisense; AAGCTGGCGGCACGACTGAATCTCA
>probe:Drosophila_2:1633895_at:699:365; Interrogation_Position=1213; Antisense; GAATCTCACCGACGCTCAGGTCAAG
>probe:Drosophila_2:1633895_at:193:201; Interrogation_Position=1250; Antisense; AACCGTCGCATGAAGTGGCGGCACA
>probe:Drosophila_2:1633895_at:162:289; Interrogation_Position=1268; Antisense; CGGCACACGCGCGAGAATCTGAAGA
>probe:Drosophila_2:1633895_at:472:377; Interrogation_Position=1303; Antisense; GAAGCAGCCGAGTGCAGTACCCGAA
>probe:Drosophila_2:1633895_at:415:673; Interrogation_Position=1320; Antisense; TACCCGAATCCGGAGGTGTCTTCAA
>probe:Drosophila_2:1633895_at:447:47; Interrogation_Position=1357; Antisense; ATCCGGTGATGGTACGCCCCAGGAG
>probe:Drosophila_2:1633895_at:302:439; Interrogation_Position=1379; Antisense; GAGGCACTCGACTACAGTTCCGATA
>probe:Drosophila_2:1633895_at:549:93; Interrogation_Position=1394; Antisense; AGTTCCGATAGCTGCTCCAGTGTGG
>probe:Drosophila_2:1633895_at:26:231; Interrogation_Position=1460; Antisense; AATGTGGTGGAGTAGAGCCGCCTAT
>probe:Drosophila_2:1633895_at:491:125; Interrogation_Position=1475; Antisense; AGCCGCCTATGTAGATAGCTCCGTT
>probe:Drosophila_2:1633895_at:416:95; Interrogation_Position=1487; Antisense; AGATAGCTCCGTTTACACGTGTAAA
>probe:Drosophila_2:1633895_at:122:483; Interrogation_Position=1525; Antisense; GTATTTATTCCTTCATTGCTAGTTG

Paste this into a BLAST search page for me
GAAGTACATCACCAAGCCAGATCGCAAGCTGGCGGCACGACTGAATCTCAGAATCTCACCGACGCTCAGGTCAAGAACCGTCGCATGAAGTGGCGGCACACGGCACACGCGCGAGAATCTGAAGAGAAGCAGCCGAGTGCAGTACCCGAATACCCGAATCCGGAGGTGTCTTCAAATCCGGTGATGGTACGCCCCAGGAGGAGGCACTCGACTACAGTTCCGATAAGTTCCGATAGCTGCTCCAGTGTGGAATGTGGTGGAGTAGAGCCGCCTATAGCCGCCTATGTAGATAGCTCCGTTAGATAGCTCCGTTTACACGTGTAAAGTATTTATTCCTTCATTGCTAGTTG

Full Affymetrix probeset data:

Annotations for 1633895_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720