Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633897_at:

>probe:Drosophila_2:1633897_at:435:357; Interrogation_Position=219; Antisense; GCAAGTAACTCCTTTGGTGCCCCAG
>probe:Drosophila_2:1633897_at:180:211; Interrogation_Position=289; Antisense; AAGAAAACGCGTCGCCGTGTGGCAT
>probe:Drosophila_2:1633897_at:27:229; Interrogation_Position=315; Antisense; AATGGCCCAACGGAGAGCTGCAAAT
>probe:Drosophila_2:1633897_at:657:117; Interrogation_Position=330; Antisense; AGCTGCAAATATCCGCGAACGCCGT
>probe:Drosophila_2:1633897_at:164:377; Interrogation_Position=346; Antisense; GAACGCCGTCGCATGTTTAACCTAA
>probe:Drosophila_2:1633897_at:585:175; Interrogation_Position=369; Antisense; AAACGAGGCCTTCGACAAGTTGCGC
>probe:Drosophila_2:1633897_at:431:423; Interrogation_Position=418; Antisense; GAGAAACGACTGTCCCGCATCGAAA
>probe:Drosophila_2:1633897_at:56:667; Interrogation_Position=463; Antisense; TACATCGGATTCATGGCTGAGCTGC
>probe:Drosophila_2:1633897_at:155:237; Interrogation_Position=515; Antisense; AATCGCGGTCCGACGTCTATGGGAG
>probe:Drosophila_2:1633897_at:168:683; Interrogation_Position=540; Antisense; TATGAATGGTCACCATCAGGCGCCA
>probe:Drosophila_2:1633897_at:21:575; Interrogation_Position=597; Antisense; GGCGGCGGCATATCAACGCGATTTC
>probe:Drosophila_2:1633897_at:622:695; Interrogation_Position=618; Antisense; TTTCGCTTCGCCCTATAATCATAGT
>probe:Drosophila_2:1633897_at:317:481; Interrogation_Position=641; Antisense; GTTTGTCCTAGTGACATTTCTCAGG
>probe:Drosophila_2:1633897_at:49:343; Interrogation_Position=696; Antisense; GCTTCTCGTCAGATCAGTTTTGTTA

Paste this into a BLAST search page for me
GCAAGTAACTCCTTTGGTGCCCCAGAAGAAAACGCGTCGCCGTGTGGCATAATGGCCCAACGGAGAGCTGCAAATAGCTGCAAATATCCGCGAACGCCGTGAACGCCGTCGCATGTTTAACCTAAAAACGAGGCCTTCGACAAGTTGCGCGAGAAACGACTGTCCCGCATCGAAATACATCGGATTCATGGCTGAGCTGCAATCGCGGTCCGACGTCTATGGGAGTATGAATGGTCACCATCAGGCGCCAGGCGGCGGCATATCAACGCGATTTCTTTCGCTTCGCCCTATAATCATAGTGTTTGTCCTAGTGACATTTCTCAGGGCTTCTCGTCAGATCAGTTTTGTTA

Full Affymetrix probeset data:

Annotations for 1633897_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime