FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633900_at:

>probe:Drosophila_2:1633900_at:648:615; Interrogation_Position=1026; Antisense; TGCAACACCTACCTAATCACGGATA
>probe:Drosophila_2:1633900_at:403:291; Interrogation_Position=1083; Antisense; CGGGTCTTCACCAGTTACGAATCAA
>probe:Drosophila_2:1633900_at:463:189; Interrogation_Position=1107; Antisense; AACATGTCCAAAACCTGCACGTGGC
>probe:Drosophila_2:1633900_at:517:353; Interrogation_Position=1123; Antisense; GCACGTGGCTCTACGAAACCTTTAA
>probe:Drosophila_2:1633900_at:539:73; Interrogation_Position=1180; Antisense; AGGAAACTGTATGCGGGCTGGCCAA
>probe:Drosophila_2:1633900_at:541:529; Interrogation_Position=1213; Antisense; GGGATCATCGCGAGGAGGTCTTCAA
>probe:Drosophila_2:1633900_at:599:435; Interrogation_Position=1227; Antisense; GAGGTCTTCAACACGGTGCGCAAGT
>probe:Drosophila_2:1633900_at:251:521; Interrogation_Position=794; Antisense; GTGGCGCATCTGTGGATTACTACTT
>probe:Drosophila_2:1633900_at:182:15; Interrogation_Position=809; Antisense; ATTACTACTTAGAGCAGCCGCGAAT
>probe:Drosophila_2:1633900_at:602:323; Interrogation_Position=828; Antisense; GCGAATTCCTCGACGCAGGCATTAA
>probe:Drosophila_2:1633900_at:395:405; Interrogation_Position=912; Antisense; GACTGTCGAAGTCTGTTACACGCCT
>probe:Drosophila_2:1633900_at:656:457; Interrogation_Position=941; Antisense; GATATCCCTAGAGGCGGCTCAGCTG
>probe:Drosophila_2:1633900_at:422:625; Interrogation_Position=970; Antisense; TGCCGCACGTGGAACTCAAGTACAT
>probe:Drosophila_2:1633900_at:247:489; Interrogation_Position=989; Antisense; GTACATGAGTCATCGGCAAGTCCTA

Paste this into a BLAST search page for me
TGCAACACCTACCTAATCACGGATACGGGTCTTCACCAGTTACGAATCAAAACATGTCCAAAACCTGCACGTGGCGCACGTGGCTCTACGAAACCTTTAAAGGAAACTGTATGCGGGCTGGCCAAGGGATCATCGCGAGGAGGTCTTCAAGAGGTCTTCAACACGGTGCGCAAGTGTGGCGCATCTGTGGATTACTACTTATTACTACTTAGAGCAGCCGCGAATGCGAATTCCTCGACGCAGGCATTAAGACTGTCGAAGTCTGTTACACGCCTGATATCCCTAGAGGCGGCTCAGCTGTGCCGCACGTGGAACTCAAGTACATGTACATGAGTCATCGGCAAGTCCTA

Full Affymetrix probeset data:

Annotations for 1633900_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720