FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633905_at:

>probe:Drosophila_2:1633905_at:636:157; Interrogation_Position=521; Antisense; ACACAGGTGATTATGGCTCCAAGCC
>probe:Drosophila_2:1633905_at:606:571; Interrogation_Position=535; Antisense; GGCTCCAAGCCTAGAAACAACTGTT
>probe:Drosophila_2:1633905_at:119:255; Interrogation_Position=552; Antisense; CAACTGTTTGGGTTCTTGTCATGAT
>probe:Drosophila_2:1633905_at:241:531; Interrogation_Position=561; Antisense; GGGTTCTTGTCATGATGATCTTTTT
>probe:Drosophila_2:1633905_at:90:699; Interrogation_Position=586; Antisense; TTTAATGCTACACAACCAAGATCGC
>probe:Drosophila_2:1633905_at:624:339; Interrogation_Position=592; Antisense; GCTACACAACCAAGATCGCAGAATG
>probe:Drosophila_2:1633905_at:705:297; Interrogation_Position=608; Antisense; CGCAGAATGATCGTGTTGATAAACT
>probe:Drosophila_2:1633905_at:677:455; Interrogation_Position=625; Antisense; GATAAACTTATCTGAAGCTCTCAAA
>probe:Drosophila_2:1633905_at:7:377; Interrogation_Position=638; Antisense; GAAGCTCTCAAAGCTGAAGCTTATC
>probe:Drosophila_2:1633905_at:724:205; Interrogation_Position=654; Antisense; AAGCTTATCGTACTTCAGTGTTAGG
>probe:Drosophila_2:1633905_at:644:291; Interrogation_Position=662; Antisense; CGTACTTCAGTGTTAGGCCTATTCT
>probe:Drosophila_2:1633905_at:183:575; Interrogation_Position=677; Antisense; GGCCTATTCTAATGATTTTACTTGT
>probe:Drosophila_2:1633905_at:51:697; Interrogation_Position=693; Antisense; TTTACTTGTGCTTATAGGCTGCCCT
>probe:Drosophila_2:1633905_at:45:151; Interrogation_Position=696; Antisense; ACTTGTGCTTATAGGCTGCCCTCCG

Paste this into a BLAST search page for me
ACACAGGTGATTATGGCTCCAAGCCGGCTCCAAGCCTAGAAACAACTGTTCAACTGTTTGGGTTCTTGTCATGATGGGTTCTTGTCATGATGATCTTTTTTTTAATGCTACACAACCAAGATCGCGCTACACAACCAAGATCGCAGAATGCGCAGAATGATCGTGTTGATAAACTGATAAACTTATCTGAAGCTCTCAAAGAAGCTCTCAAAGCTGAAGCTTATCAAGCTTATCGTACTTCAGTGTTAGGCGTACTTCAGTGTTAGGCCTATTCTGGCCTATTCTAATGATTTTACTTGTTTTACTTGTGCTTATAGGCTGCCCTACTTGTGCTTATAGGCTGCCCTCCG

Full Affymetrix probeset data:

Annotations for 1633905_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720