FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633906_at:

>probe:Drosophila_2:1633906_at:180:67; Interrogation_Position=310; Antisense; ATGGCTTTCGATCAGTGCCGTTCAG
>probe:Drosophila_2:1633906_at:248:97; Interrogation_Position=358; Antisense; AGATCCAATGGAGGCCTTCGAGGCG
>probe:Drosophila_2:1633906_at:518:71; Interrogation_Position=378; Antisense; AGGCGGCGCAGTTCTACACCATGTT
>probe:Drosophila_2:1633906_at:444:471; Interrogation_Position=400; Antisense; GTTCTTCATGAAGCCGCGCGGGAAA
>probe:Drosophila_2:1633906_at:235:681; Interrogation_Position=425; Antisense; TATGTGGTCAGTGTGTGCACCTCGA
>probe:Drosophila_2:1633906_at:130:401; Interrogation_Position=533; Antisense; GACATGCAGTTCACGCTCAAGGAGG
>probe:Drosophila_2:1633906_at:215:79; Interrogation_Position=555; Antisense; AGGATTACTGCATGGGCGCCTGTGT
>probe:Drosophila_2:1633906_at:132:215; Interrogation_Position=632; Antisense; AAGAGTCTGGCCAACATCCTGGCGG
>probe:Drosophila_2:1633906_at:416:47; Interrogation_Position=647; Antisense; ATCCTGGCGGATCTGCGCAATGACA
>probe:Drosophila_2:1633906_at:392:195; Interrogation_Position=695; Antisense; AACGGTAGGTTTGCCAGTGAGCCCA
>probe:Drosophila_2:1633906_at:462:511; Interrogation_Position=711; Antisense; GTGAGCCCAAGGGTGGACTTACCAC
>probe:Drosophila_2:1633906_at:432:321; Interrogation_Position=757; Antisense; GCCCGGCTTCATGATGCAGAAACTA
>probe:Drosophila_2:1633906_at:515:389; Interrogation_Position=775; Antisense; GAAACTACCAGATCCGAAGACCAAG
>probe:Drosophila_2:1633906_at:131:173; Interrogation_Position=828; Antisense; AAAGCAATAAATTCCGCCTGCCTTC

Paste this into a BLAST search page for me
ATGGCTTTCGATCAGTGCCGTTCAGAGATCCAATGGAGGCCTTCGAGGCGAGGCGGCGCAGTTCTACACCATGTTGTTCTTCATGAAGCCGCGCGGGAAATATGTGGTCAGTGTGTGCACCTCGAGACATGCAGTTCACGCTCAAGGAGGAGGATTACTGCATGGGCGCCTGTGTAAGAGTCTGGCCAACATCCTGGCGGATCCTGGCGGATCTGCGCAATGACAAACGGTAGGTTTGCCAGTGAGCCCAGTGAGCCCAAGGGTGGACTTACCACGCCCGGCTTCATGATGCAGAAACTAGAAACTACCAGATCCGAAGACCAAGAAAGCAATAAATTCCGCCTGCCTTC

Full Affymetrix probeset data:

Annotations for 1633906_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720