FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633908_at:

>probe:Drosophila_2:1633908_at:420:323; Interrogation_Position=183; Antisense; GCGCTATGTGCGCAAGGAGTACAAT
>probe:Drosophila_2:1633908_at:250:431; Interrogation_Position=199; Antisense; GAGTACAATCGGGATCTCCTCGACT
>probe:Drosophila_2:1633908_at:630:281; Interrogation_Position=214; Antisense; CTCCTCGACTGGTTCAACAACGTGG
>probe:Drosophila_2:1633908_at:660:185; Interrogation_Position=229; Antisense; AACAACGTGGGCGTGGGACAGTTCA
>probe:Drosophila_2:1633908_at:2:325; Interrogation_Position=288; Antisense; GCTGATCCTCGAGAACTCCTTGGGC
>probe:Drosophila_2:1633908_at:278:271; Interrogation_Position=314; Antisense; CATCCGTGCCCATCAGGAAGCGCAA
>probe:Drosophila_2:1633908_at:390:563; Interrogation_Position=329; Antisense; GGAAGCGCAACTCGGAGCTAATCAA
>probe:Drosophila_2:1633908_at:270:239; Interrogation_Position=348; Antisense; AATCAACTCCTTGTTGAGTCTGCCC
>probe:Drosophila_2:1633908_at:604:431; Interrogation_Position=363; Antisense; GAGTCTGCCCAAGAACATGAACGAT
>probe:Drosophila_2:1633908_at:378:231; Interrogation_Position=408; Antisense; AATGCTGAAGGATTAGGACGACCCA
>probe:Drosophila_2:1633908_at:661:679; Interrogation_Position=421; Antisense; TAGGACGACCCACCACTGAAAGATG
>probe:Drosophila_2:1633908_at:463:57; Interrogation_Position=482; Antisense; ATGATTTTTTGGTGCGTCGAAGGAA
>probe:Drosophila_2:1633908_at:76:175; Interrogation_Position=525; Antisense; AAAGCCGGTGTAGTCATCTAATAGA
>probe:Drosophila_2:1633908_at:322:139; Interrogation_Position=654; Antisense; ACGTTTTCTGGATTGTTTCGACTTG

Paste this into a BLAST search page for me
GCGCTATGTGCGCAAGGAGTACAATGAGTACAATCGGGATCTCCTCGACTCTCCTCGACTGGTTCAACAACGTGGAACAACGTGGGCGTGGGACAGTTCAGCTGATCCTCGAGAACTCCTTGGGCCATCCGTGCCCATCAGGAAGCGCAAGGAAGCGCAACTCGGAGCTAATCAAAATCAACTCCTTGTTGAGTCTGCCCGAGTCTGCCCAAGAACATGAACGATAATGCTGAAGGATTAGGACGACCCATAGGACGACCCACCACTGAAAGATGATGATTTTTTGGTGCGTCGAAGGAAAAAGCCGGTGTAGTCATCTAATAGAACGTTTTCTGGATTGTTTCGACTTG

Full Affymetrix probeset data:

Annotations for 1633908_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720