Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633912_at:

>probe:Drosophila_2:1633912_at:547:235; Interrogation_Position=342; Antisense; AATCCGGTCGTGATGATCCCATTGA
>probe:Drosophila_2:1633912_at:571:221; Interrogation_Position=374; Antisense; AAGGTACTAGCTTTCGGGCAACTAT
>probe:Drosophila_2:1633912_at:492:249; Interrogation_Position=412; Antisense; CAATATCTCCGACAAGTTGCTTGCC
>probe:Drosophila_2:1633912_at:665:719; Interrogation_Position=432; Antisense; TTGCCACTCTGTTGGGTGCCCGAAA
>probe:Drosophila_2:1633912_at:532:637; Interrogation_Position=499; Antisense; TCGTGATGATACAGAACCCGTCCGC
>probe:Drosophila_2:1633912_at:263:395; Interrogation_Position=554; Antisense; GAAATCATTTCCAAGGTCGCCGATC
>probe:Drosophila_2:1633912_at:423:39; Interrogation_Position=576; Antisense; ATCTGCGCTGCGATTTCACTGAAAA
>probe:Drosophila_2:1633912_at:530:201; Interrogation_Position=609; Antisense; AACCGACTCTGCTTCGCGAGGATTA
>probe:Drosophila_2:1633912_at:359:595; Interrogation_Position=656; Antisense; TGGGCCAGAAACTGTCATCTACCTT
>probe:Drosophila_2:1633912_at:65:131; Interrogation_Position=712; Antisense; ACCTCTGAGCCCTTTTGCTAATTGA
>probe:Drosophila_2:1633912_at:591:247; Interrogation_Position=799; Antisense; CACGTATACGACAAGAGGGCCCTCT
>probe:Drosophila_2:1633912_at:369:357; Interrogation_Position=825; Antisense; GCAAACACCTGTCGCTATGGTTTTT
>probe:Drosophila_2:1633912_at:661:123; Interrogation_Position=897; Antisense; AGCCGACTTAGTTGAATTCCTGCAC
>probe:Drosophila_2:1633912_at:284:615; Interrogation_Position=909; Antisense; TGAATTCCTGCACTCAGCTGACAAA

Paste this into a BLAST search page for me
AATCCGGTCGTGATGATCCCATTGAAAGGTACTAGCTTTCGGGCAACTATCAATATCTCCGACAAGTTGCTTGCCTTGCCACTCTGTTGGGTGCCCGAAATCGTGATGATACAGAACCCGTCCGCGAAATCATTTCCAAGGTCGCCGATCATCTGCGCTGCGATTTCACTGAAAAAACCGACTCTGCTTCGCGAGGATTATGGGCCAGAAACTGTCATCTACCTTACCTCTGAGCCCTTTTGCTAATTGACACGTATACGACAAGAGGGCCCTCTGCAAACACCTGTCGCTATGGTTTTTAGCCGACTTAGTTGAATTCCTGCACTGAATTCCTGCACTCAGCTGACAAA

Full Affymetrix probeset data:

Annotations for 1633912_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime