FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633913_at:

>probe:Drosophila_2:1633913_at:449:691; Interrogation_Position=104; Antisense; TTTCCAAGTGGAAGGACTACCCCAT
>probe:Drosophila_2:1633913_at:616:139; Interrogation_Position=138; Antisense; ACGTCGCCGTCACCAATGATGGAAA
>probe:Drosophila_2:1633913_at:728:519; Interrogation_Position=168; Antisense; GTGGAGCAGGCCTACGACGATAAGT
>probe:Drosophila_2:1633913_at:323:427; Interrogation_Position=213; Antisense; GAGATCCTTAACCAAGAGCGACTGT
>probe:Drosophila_2:1633913_at:712:89; Interrogation_Position=22; Antisense; TCGATTCGAAAATGGGACAGCCCGG
>probe:Drosophila_2:1633913_at:458:615; Interrogation_Position=276; Antisense; TGCACTCCCGATGCCAAGATGTTGA
>probe:Drosophila_2:1633913_at:249:59; Interrogation_Position=294; Antisense; ATGTTGAAGGAGATCCTGCCCGACG
>probe:Drosophila_2:1633913_at:727:263; Interrogation_Position=320; Antisense; CATCCAAACCGATTGCACCAAGTGC
>probe:Drosophila_2:1633913_at:4:185; Interrogation_Position=370; Antisense; AAAAGGTGACCCGTCATCTCATCGA
>probe:Drosophila_2:1633913_at:368:213; Interrogation_Position=426; Antisense; AAGATCTACGATCCCGAGGGAACCT
>probe:Drosophila_2:1633913_at:360:525; Interrogation_Position=443; Antisense; GGGAACCTACCGCATCAAATACCAG
>probe:Drosophila_2:1633913_at:130:653; Interrogation_Position=501; Antisense; TCAATCTCTATTTTACGTCGTTTTT
>probe:Drosophila_2:1633913_at:173:305; Interrogation_Position=58; Antisense; CCATTGGGCACGTTTCGTTGGTGGT
>probe:Drosophila_2:1633913_at:83:607; Interrogation_Position=88; Antisense; TGATGTGCACCACCTGTTTCCAAGT

Paste this into a BLAST search page for me
TTTCCAAGTGGAAGGACTACCCCATACGTCGCCGTCACCAATGATGGAAAGTGGAGCAGGCCTACGACGATAAGTGAGATCCTTAACCAAGAGCGACTGTTCGATTCGAAAATGGGACAGCCCGGTGCACTCCCGATGCCAAGATGTTGAATGTTGAAGGAGATCCTGCCCGACGCATCCAAACCGATTGCACCAAGTGCAAAAGGTGACCCGTCATCTCATCGAAAGATCTACGATCCCGAGGGAACCTGGGAACCTACCGCATCAAATACCAGTCAATCTCTATTTTACGTCGTTTTTCCATTGGGCACGTTTCGTTGGTGGTTGATGTGCACCACCTGTTTCCAAGT

Full Affymetrix probeset data:

Annotations for 1633913_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720