Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633914_at:

>probe:Drosophila_2:1633914_at:477:573; Interrogation_Position=1760; Antisense; GGCGGCGCGAACACACTGACGAGAA
>probe:Drosophila_2:1633914_at:595:287; Interrogation_Position=1801; Antisense; CTGGCAAGGCAACGCATTCTTCGAA
>probe:Drosophila_2:1633914_at:195:295; Interrogation_Position=1822; Antisense; CGAAACGGACCAATACTCTACACTG
>probe:Drosophila_2:1633914_at:45:517; Interrogation_Position=1867; Antisense; GTGGGCGACACCTATTTGAACATGG
>probe:Drosophila_2:1633914_at:593:453; Interrogation_Position=1927; Antisense; TTTAATTTGGGACGCTACTGGCCTG
>probe:Drosophila_2:1633914_at:101:79; Interrogation_Position=1964; Antisense; AGGTCACCTTATATGTGCCCAACGA
>probe:Drosophila_2:1633914_at:319:535; Interrogation_Position=2002; Antisense; GGTGAAAACTCTCTGGTGATCCTTG
>probe:Drosophila_2:1633914_at:425:513; Interrogation_Position=2017; Antisense; GTGATCCTTGAGTACCAACGAGCGA
>probe:Drosophila_2:1633914_at:430:327; Interrogation_Position=2057; Antisense; GCGAGGATCTACCTGCAGTGCAGTT
>probe:Drosophila_2:1633914_at:392:85; Interrogation_Position=2073; Antisense; AGTGCAGTTCGACGCAGTTGCTCAG
>probe:Drosophila_2:1633914_at:423:415; Interrogation_Position=2135; Antisense; GAGCCTTGTATGCATTGTTATTCCG
>probe:Drosophila_2:1633914_at:220:515; Interrogation_Position=2195; Antisense; GTGTCAACAACCTTCGTTAAGCTTT
>probe:Drosophila_2:1633914_at:573:605; Interrogation_Position=2278; Antisense; TGATCTGTGCTTGACTGACTCTTAT
>probe:Drosophila_2:1633914_at:676:609; Interrogation_Position=2293; Antisense; TGACTCTTATCGATCTCCAGCTTAT

Paste this into a BLAST search page for me
GGCGGCGCGAACACACTGACGAGAACTGGCAAGGCAACGCATTCTTCGAACGAAACGGACCAATACTCTACACTGGTGGGCGACACCTATTTGAACATGGTTTAATTTGGGACGCTACTGGCCTGAGGTCACCTTATATGTGCCCAACGAGGTGAAAACTCTCTGGTGATCCTTGGTGATCCTTGAGTACCAACGAGCGAGCGAGGATCTACCTGCAGTGCAGTTAGTGCAGTTCGACGCAGTTGCTCAGGAGCCTTGTATGCATTGTTATTCCGGTGTCAACAACCTTCGTTAAGCTTTTGATCTGTGCTTGACTGACTCTTATTGACTCTTATCGATCTCCAGCTTAT

Full Affymetrix probeset data:

Annotations for 1633914_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime