FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633915_at:

>probe:Drosophila_2:1633915_at:245:421; Interrogation_Position=1020; Antisense; GAGATTACGGTATCCCCGGTTGTCT
>probe:Drosophila_2:1633915_at:231:271; Interrogation_Position=1043; Antisense; CTTAGTAAAACAGAGGCCGCCCATG
>probe:Drosophila_2:1633915_at:561:405; Interrogation_Position=1174; Antisense; GACGTCGTCAGTCACCCATGAGGAA
>probe:Drosophila_2:1633915_at:128:607; Interrogation_Position=1192; Antisense; TGAGGAACCGGCGTTCACCACGGCG
>probe:Drosophila_2:1633915_at:49:503; Interrogation_Position=1240; Antisense; GTCGACGCCGCAGCAATAGCAGTGA
>probe:Drosophila_2:1633915_at:560:25; Interrogation_Position=1255; Antisense; ATAGCAGTGACAGCTCTCGTTAGAG
>probe:Drosophila_2:1633915_at:627:143; Interrogation_Position=1283; Antisense; ACTGATCGACTCCTAGTTTCTACAA
>probe:Drosophila_2:1633915_at:383:397; Interrogation_Position=1310; Antisense; GACACGATTATTGCACTTTTCTTTA
>probe:Drosophila_2:1633915_at:616:177; Interrogation_Position=801; Antisense; AAACAGGTGCGCATTCATGTCGGTC
>probe:Drosophila_2:1633915_at:467:127; Interrogation_Position=843; Antisense; ACCAAGGACCATGTGTTCGAGATAT
>probe:Drosophila_2:1633915_at:608:587; Interrogation_Position=895; Antisense; TGGAGTTTCCCGTAGATCGTTTTCA
>probe:Drosophila_2:1633915_at:340:41; Interrogation_Position=910; Antisense; ATCGTTTTCATCCTAACTTCGGACG
>probe:Drosophila_2:1633915_at:225:585; Interrogation_Position=949; Antisense; TGGAATATGCCACACCCGAGGATTG
>probe:Drosophila_2:1633915_at:154:697; Interrogation_Position=971; Antisense; TTGTGAGTCGGCCATGAAGCATATG

Paste this into a BLAST search page for me
GAGATTACGGTATCCCCGGTTGTCTCTTAGTAAAACAGAGGCCGCCCATGGACGTCGTCAGTCACCCATGAGGAATGAGGAACCGGCGTTCACCACGGCGGTCGACGCCGCAGCAATAGCAGTGAATAGCAGTGACAGCTCTCGTTAGAGACTGATCGACTCCTAGTTTCTACAAGACACGATTATTGCACTTTTCTTTAAAACAGGTGCGCATTCATGTCGGTCACCAAGGACCATGTGTTCGAGATATTGGAGTTTCCCGTAGATCGTTTTCAATCGTTTTCATCCTAACTTCGGACGTGGAATATGCCACACCCGAGGATTGTTGTGAGTCGGCCATGAAGCATATG

Full Affymetrix probeset data:

Annotations for 1633915_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720