FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633916_at:

>probe:Drosophila_2:1633916_at:161:405; Interrogation_Position=1014; Antisense; GACTCAGCAACGAGCGGTTCACCAA
>probe:Drosophila_2:1633916_at:548:527; Interrogation_Position=1050; Antisense; GGGACAGCAATCAGGACCTCAGCAT
>probe:Drosophila_2:1633916_at:470:77; Interrogation_Position=1109; Antisense; AGGATCTGGAGCTCGGGTTCGCCAT
>probe:Drosophila_2:1633916_at:233:541; Interrogation_Position=1124; Antisense; GGTTCGCCATCGAGCGCAGCATGTT
>probe:Drosophila_2:1633916_at:531:351; Interrogation_Position=1139; Antisense; GCAGCATGTTCGTAGGAGCCTCAAA
>probe:Drosophila_2:1633916_at:340:75; Interrogation_Position=1152; Antisense; AGGAGCCTCAAACGCTGATCAAGGA
>probe:Drosophila_2:1633916_at:339:33; Interrogation_Position=1169; Antisense; ATCAAGGAGGCGATTTCATCCTGCC
>probe:Drosophila_2:1633916_at:570:645; Interrogation_Position=1184; Antisense; TCATCCTGCCATACGGACAAGTTTT
>probe:Drosophila_2:1633916_at:9:147; Interrogation_Position=1200; Antisense; ACAAGTTTTCCGCTTTGCCAACACT
>probe:Drosophila_2:1633916_at:420:123; Interrogation_Position=1233; Antisense; AGCGCGCCCTTCCAACGGGAATGGA
>probe:Drosophila_2:1633916_at:289:229; Interrogation_Position=1252; Antisense; AATGGATCCGGCTCTGGTGTCATGA
>probe:Drosophila_2:1633916_at:113:133; Interrogation_Position=1293; Antisense; ACCCGTGCCGAATAATCCGCGAAAT
>probe:Drosophila_2:1633916_at:616:655; Interrogation_Position=1305; Antisense; TAATCCGCGAAATGCGTCCGCACAT
>probe:Drosophila_2:1633916_at:174:661; Interrogation_Position=995; Antisense; TAACGCAGGCGGTGATCCAGACTCA

Paste this into a BLAST search page for me
GACTCAGCAACGAGCGGTTCACCAAGGGACAGCAATCAGGACCTCAGCATAGGATCTGGAGCTCGGGTTCGCCATGGTTCGCCATCGAGCGCAGCATGTTGCAGCATGTTCGTAGGAGCCTCAAAAGGAGCCTCAAACGCTGATCAAGGAATCAAGGAGGCGATTTCATCCTGCCTCATCCTGCCATACGGACAAGTTTTACAAGTTTTCCGCTTTGCCAACACTAGCGCGCCCTTCCAACGGGAATGGAAATGGATCCGGCTCTGGTGTCATGAACCCGTGCCGAATAATCCGCGAAATTAATCCGCGAAATGCGTCCGCACATTAACGCAGGCGGTGATCCAGACTCA

Full Affymetrix probeset data:

Annotations for 1633916_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720