FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633920_at:

>probe:Drosophila_2:1633920_at:434:575; Interrogation_Position=334; Antisense; GGCGTTGTGCCCTACGAGATCAAAG
>probe:Drosophila_2:1633920_at:653:29; Interrogation_Position=352; Antisense; ATCAAAGGTCCTTTTACCAGCCAGG
>probe:Drosophila_2:1633920_at:155:221; Interrogation_Position=454; Antisense; AAGGATTACATCTCCATTGGTAGCG
>probe:Drosophila_2:1633920_at:21:565; Interrogation_Position=525; Antisense; GGAAGTGAATCTGCAGTCGCCCAAC
>probe:Drosophila_2:1633920_at:172:195; Interrogation_Position=547; Antisense; AACTGCTTGCGTACATACGGCACTC
>probe:Drosophila_2:1633920_at:303:287; Interrogation_Position=595; Antisense; CTGGGCTTCTTCCATGAGCAGAATC
>probe:Drosophila_2:1633920_at:649:511; Interrogation_Position=629; Antisense; GTGACTCCTATGTGCGCGTGATGAA
>probe:Drosophila_2:1633920_at:568:187; Interrogation_Position=682; Antisense; AACTTCGAGAAGTCCAGTTCCAGGA
>probe:Drosophila_2:1633920_at:728:91; Interrogation_Position=697; Antisense; AGTTCCAGGACACAGTACGGCTTCG
>probe:Drosophila_2:1633920_at:147:669; Interrogation_Position=712; Antisense; TACGGCTTCGGCGTGGAATACGACT
>probe:Drosophila_2:1633920_at:149:129; Interrogation_Position=763; Antisense; ACCAGTTTCACTCGGAATGGCCAGC
>probe:Drosophila_2:1633920_at:269:371; Interrogation_Position=777; Antisense; GAATGGCCAGCCCACGTTGAAGGCA
>probe:Drosophila_2:1633920_at:70:443; Interrogation_Position=828; Antisense; GATGGGTCAACGCAAGGGCTTCTCA
>probe:Drosophila_2:1633920_at:152:643; Interrogation_Position=848; Antisense; TCTCAGCCGGAGATGTGCGCAAGAT

Paste this into a BLAST search page for me
GGCGTTGTGCCCTACGAGATCAAAGATCAAAGGTCCTTTTACCAGCCAGGAAGGATTACATCTCCATTGGTAGCGGGAAGTGAATCTGCAGTCGCCCAACAACTGCTTGCGTACATACGGCACTCCTGGGCTTCTTCCATGAGCAGAATCGTGACTCCTATGTGCGCGTGATGAAAACTTCGAGAAGTCCAGTTCCAGGAAGTTCCAGGACACAGTACGGCTTCGTACGGCTTCGGCGTGGAATACGACTACCAGTTTCACTCGGAATGGCCAGCGAATGGCCAGCCCACGTTGAAGGCAGATGGGTCAACGCAAGGGCTTCTCATCTCAGCCGGAGATGTGCGCAAGAT

Full Affymetrix probeset data:

Annotations for 1633920_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720