FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633921_at:

>probe:Drosophila_2:1633921_at:499:131; Interrogation_Position=125; Antisense; ACCGGACCATGGAGGCTTCTGTGAA
>probe:Drosophila_2:1633921_at:491:267; Interrogation_Position=174; Antisense; CAGTGGTTCACTTCGAGTGTCCATA
>probe:Drosophila_2:1633921_at:611:83; Interrogation_Position=189; Antisense; AGTGTCCATACCCAATGCCAAGAAG
>probe:Drosophila_2:1633921_at:685:273; Interrogation_Position=19; Antisense; CTTGATCAACGGAACATGGGCTACT
>probe:Drosophila_2:1633921_at:261:463; Interrogation_Position=279; Antisense; GATTCTCATCGATCTTTTGGTCAAC
>probe:Drosophila_2:1633921_at:541:537; Interrogation_Position=297; Antisense; GGTCAACACTTTGGCCAAGAACAGC
>probe:Drosophila_2:1633921_at:174:67; Interrogation_Position=329; Antisense; AGGCTTGGAGATGTCCTTTTCCAAA
>probe:Drosophila_2:1633921_at:100:453; Interrogation_Position=388; Antisense; GATCTGCCGCCAATGCTAACCGAAT
>probe:Drosophila_2:1633921_at:11:509; Interrogation_Position=424; Antisense; GTGAACTTGGACTTCTTTATACCCA
>probe:Drosophila_2:1633921_at:204:523; Interrogation_Position=451; Antisense; GTGGCCATTGCCATGAATGTCACCT
>probe:Drosophila_2:1633921_at:177:231; Interrogation_Position=466; Antisense; AATGTCACCTTACATGGGCATCTCT
>probe:Drosophila_2:1633921_at:617:591; Interrogation_Position=71; Antisense; TGGGCAATCCCAACTATTTCGCGAA
>probe:Drosophila_2:1633921_at:171:149; Interrogation_Position=83; Antisense; ACTATTTCGCGAACCTGTACTGCAG
>probe:Drosophila_2:1633921_at:210:489; Interrogation_Position=99; Antisense; GTACTGCAGGATTATACCACCCAAA

Paste this into a BLAST search page for me
ACCGGACCATGGAGGCTTCTGTGAACAGTGGTTCACTTCGAGTGTCCATAAGTGTCCATACCCAATGCCAAGAAGCTTGATCAACGGAACATGGGCTACTGATTCTCATCGATCTTTTGGTCAACGGTCAACACTTTGGCCAAGAACAGCAGGCTTGGAGATGTCCTTTTCCAAAGATCTGCCGCCAATGCTAACCGAATGTGAACTTGGACTTCTTTATACCCAGTGGCCATTGCCATGAATGTCACCTAATGTCACCTTACATGGGCATCTCTTGGGCAATCCCAACTATTTCGCGAAACTATTTCGCGAACCTGTACTGCAGGTACTGCAGGATTATACCACCCAAA

Full Affymetrix probeset data:

Annotations for 1633921_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720