FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633923_at:

>probe:Drosophila_2:1633923_at:343:707; Interrogation_Position=1022; Antisense; TTAGCGACTTCTTTCCCAAGATGAC
>probe:Drosophila_2:1633923_at:162:281; Interrogation_Position=1048; Antisense; CTCAAACCGAATCCGCAGTGCGATG
>probe:Drosophila_2:1633923_at:269:287; Interrogation_Position=1189; Antisense; CTGGTCGCCGAGGATGCGCCAGAAA
>probe:Drosophila_2:1633923_at:115:265; Interrogation_Position=1208; Antisense; CAGAAAGTAATACAACGCCCGCCGA
>probe:Drosophila_2:1633923_at:600:137; Interrogation_Position=1268; Antisense; ACGAGGCTCCTGAGAAGTCCAGCGA
>probe:Drosophila_2:1633923_at:406:391; Interrogation_Position=1303; Antisense; GAAACTGTATCTGCAGCTACCGCGG
>probe:Drosophila_2:1633923_at:40:657; Interrogation_Position=1320; Antisense; TACCGCGGACGAAACCAGTCTGGAA
>probe:Drosophila_2:1633923_at:188:87; Interrogation_Position=1336; Antisense; AGTCTGGAAGACCTGATGGCGCAAA
>probe:Drosophila_2:1633923_at:718:247; Interrogation_Position=1374; Antisense; AATTGATTCCGTACTCCGTATTTAT
>probe:Drosophila_2:1633923_at:293:455; Interrogation_Position=1432; Antisense; GATAAACTCAGCTTCGATTTGTGTA
>probe:Drosophila_2:1633923_at:452:191; Interrogation_Position=927; Antisense; AACTATGGGCATTACGGCTGGCTTC
>probe:Drosophila_2:1633923_at:79:343; Interrogation_Position=947; Antisense; GCTTCCTTGTCCAGAACGCATTAAA
>probe:Drosophila_2:1633923_at:544:363; Interrogation_Position=981; Antisense; GAATTTCGGCGAGGTCTCTGACTAT
>probe:Drosophila_2:1633923_at:638:497; Interrogation_Position=994; Antisense; GTCTCTGACTATCTGGGCTACAATG

Paste this into a BLAST search page for me
TTAGCGACTTCTTTCCCAAGATGACCTCAAACCGAATCCGCAGTGCGATGCTGGTCGCCGAGGATGCGCCAGAAACAGAAAGTAATACAACGCCCGCCGAACGAGGCTCCTGAGAAGTCCAGCGAGAAACTGTATCTGCAGCTACCGCGGTACCGCGGACGAAACCAGTCTGGAAAGTCTGGAAGACCTGATGGCGCAAAAATTGATTCCGTACTCCGTATTTATGATAAACTCAGCTTCGATTTGTGTAAACTATGGGCATTACGGCTGGCTTCGCTTCCTTGTCCAGAACGCATTAAAGAATTTCGGCGAGGTCTCTGACTATGTCTCTGACTATCTGGGCTACAATG

Full Affymetrix probeset data:

Annotations for 1633923_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720