FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633926_at:

>probe:Drosophila_2:1633926_at:79:541; Interrogation_Position=126; Antisense; GGTTATTCGCAGTCGATCCTACGAT
>probe:Drosophila_2:1633926_at:142:323; Interrogation_Position=185; Antisense; GCGCCCGAGACATCATGATCTTGGA
>probe:Drosophila_2:1633926_at:412:641; Interrogation_Position=203; Antisense; TCTTGGATAGCCATGGAGTGCCCCT
>probe:Drosophila_2:1633926_at:264:617; Interrogation_Position=238; Antisense; TGCAGTCAGAGACGCACCTTCGTGT
>probe:Drosophila_2:1633926_at:501:717; Interrogation_Position=256; Antisense; TTCGTGTTCGTCTCTAACCTGAAGC
>probe:Drosophila_2:1633926_at:467:67; Interrogation_Position=292; Antisense; ATGGCCCGCAACGTGGTCAGGGATC
>probe:Drosophila_2:1633926_at:12:297; Interrogation_Position=326; Antisense; CGAACGACATAACCTTCATGCGGAT
>probe:Drosophila_2:1633926_at:510:275; Interrogation_Position=33; Antisense; CTAGTTACATTTGCGAAGCCCGAAA
>probe:Drosophila_2:1633926_at:30:269; Interrogation_Position=342; Antisense; CATGCGGATTCGCTCCAATATGGGC
>probe:Drosophila_2:1633926_at:688:583; Interrogation_Position=362; Antisense; TGGGCGAAATCCACATGACCCTGGG
>probe:Drosophila_2:1633926_at:628:525; Interrogation_Position=384; Antisense; GGGCACGGACTTCATTTTGATCGTT
>probe:Drosophila_2:1633926_at:686:269; Interrogation_Position=443; Antisense; CATCATAAAACATTTCCGGTCGCTG
>probe:Drosophila_2:1633926_at:266:5; Interrogation_Position=491; Antisense; ATTGTACTGTATCCATATTCCACCC
>probe:Drosophila_2:1633926_at:137:281; Interrogation_Position=92; Antisense; CTCAGCGCAAAAGCACTCCAGTGGT

Paste this into a BLAST search page for me
GGTTATTCGCAGTCGATCCTACGATGCGCCCGAGACATCATGATCTTGGATCTTGGATAGCCATGGAGTGCCCCTTGCAGTCAGAGACGCACCTTCGTGTTTCGTGTTCGTCTCTAACCTGAAGCATGGCCCGCAACGTGGTCAGGGATCCGAACGACATAACCTTCATGCGGATCTAGTTACATTTGCGAAGCCCGAAACATGCGGATTCGCTCCAATATGGGCTGGGCGAAATCCACATGACCCTGGGGGGCACGGACTTCATTTTGATCGTTCATCATAAAACATTTCCGGTCGCTGATTGTACTGTATCCATATTCCACCCCTCAGCGCAAAAGCACTCCAGTGGT

Full Affymetrix probeset data:

Annotations for 1633926_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720