Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633928_at:

>probe:Drosophila_2:1633928_at:601:121; Interrogation_Position=1983; Antisense; AGCGGAGCCTACTTATTCATCGTAT
>probe:Drosophila_2:1633928_at:608:269; Interrogation_Position=2000; Antisense; CATCGTATCCAACGTATTCAGCCTC
>probe:Drosophila_2:1633928_at:270:13; Interrogation_Position=2015; Antisense; ATTCAGCCTCCAGTGTCTATAAGAC
>probe:Drosophila_2:1633928_at:239:403; Interrogation_Position=2037; Antisense; GACTTATCCAACCTATGCATCAACT
>probe:Drosophila_2:1633928_at:309:619; Interrogation_Position=2052; Antisense; TGCATCAACTGAAGCCCCTAAGAAT
>probe:Drosophila_2:1633928_at:201:389; Interrogation_Position=2080; Antisense; GAAACTACTAAGATGGCCCTCGACA
>probe:Drosophila_2:1633928_at:507:437; Interrogation_Position=2091; Antisense; GATGGCCCTCGACAAGTTAGTCAAA
>probe:Drosophila_2:1633928_at:682:187; Interrogation_Position=2169; Antisense; AACGGAGCCCATCACAACTAAAGCG
>probe:Drosophila_2:1633928_at:376:253; Interrogation_Position=2195; Antisense; CAACCACTTATCCATCATATCAGAC
>probe:Drosophila_2:1633928_at:613:35; Interrogation_Position=2213; Antisense; ATCAGACTTATACATCCTCGAGTGT
>probe:Drosophila_2:1633928_at:369:217; Interrogation_Position=2244; Antisense; AAGTTATAGCTCTTCCGAGACTCCG
>probe:Drosophila_2:1633928_at:381:113; Interrogation_Position=2290; Antisense; AGCACTGCCAATCCCTTGAACAAAT
>probe:Drosophila_2:1633928_at:379:31; Interrogation_Position=2323; Antisense; ATCAATGCAGTCTCCGATCCAGAAA
>probe:Drosophila_2:1633928_at:578:247; Interrogation_Position=2430; Antisense; AATTGATGCAGACAGTGTGGCCAAA

Paste this into a BLAST search page for me
AGCGGAGCCTACTTATTCATCGTATCATCGTATCCAACGTATTCAGCCTCATTCAGCCTCCAGTGTCTATAAGACGACTTATCCAACCTATGCATCAACTTGCATCAACTGAAGCCCCTAAGAATGAAACTACTAAGATGGCCCTCGACAGATGGCCCTCGACAAGTTAGTCAAAAACGGAGCCCATCACAACTAAAGCGCAACCACTTATCCATCATATCAGACATCAGACTTATACATCCTCGAGTGTAAGTTATAGCTCTTCCGAGACTCCGAGCACTGCCAATCCCTTGAACAAATATCAATGCAGTCTCCGATCCAGAAAAATTGATGCAGACAGTGTGGCCAAA

Full Affymetrix probeset data:

Annotations for 1633928_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime