Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633930_at:

>probe:Drosophila_2:1633930_at:77:113; Interrogation_Position=280; Antisense; AGCACCAGGATTAGGATCAGCCGGC
>probe:Drosophila_2:1633930_at:200:629; Interrogation_Position=347; Antisense; TCCATGCTACCATACGCCGGAGGAG
>probe:Drosophila_2:1633930_at:309:521; Interrogation_Position=471; Antisense; GTGGCATGCCCATTACAGGAGCCCA
>probe:Drosophila_2:1633930_at:469:75; Interrogation_Position=487; Antisense; AGGAGCCCAGCATATAGTGCCGCCA
>probe:Drosophila_2:1633930_at:371:259; Interrogation_Position=510; Antisense; CACCCGTGGACCGTTCAATATATGG
>probe:Drosophila_2:1633930_at:197:25; Interrogation_Position=529; Antisense; ATATGGAGACATACCCGGACGAAAT
>probe:Drosophila_2:1633930_at:460:229; Interrogation_Position=551; Antisense; AATGAACCGTGCATCGACAATGGCG
>probe:Drosophila_2:1633930_at:312:57; Interrogation_Position=605; Antisense; ATGAGCATGAACTACGGCGGAGGCA
>probe:Drosophila_2:1633930_at:319:569; Interrogation_Position=626; Antisense; GGCAGTGCATCCAAGGGTGGCTTCT
>probe:Drosophila_2:1633930_at:500:343; Interrogation_Position=645; Antisense; GCTTCTGGTAGGATCGATGCCACGA
>probe:Drosophila_2:1633930_at:109:613; Interrogation_Position=674; Antisense; TGACAGCACGAGCATCTTCACCGAA
>probe:Drosophila_2:1633930_at:682:169; Interrogation_Position=704; Antisense; AAAGTGAATCGCATATGGGCCATAT
>probe:Drosophila_2:1633930_at:40:177; Interrogation_Position=753; Antisense; AAACGTCCGTTTTGTGCAGCTCAAA
>probe:Drosophila_2:1633930_at:234:597; Interrogation_Position=765; Antisense; TGTGCAGCTCAAACGACTCGTACTT

Paste this into a BLAST search page for me
AGCACCAGGATTAGGATCAGCCGGCTCCATGCTACCATACGCCGGAGGAGGTGGCATGCCCATTACAGGAGCCCAAGGAGCCCAGCATATAGTGCCGCCACACCCGTGGACCGTTCAATATATGGATATGGAGACATACCCGGACGAAATAATGAACCGTGCATCGACAATGGCGATGAGCATGAACTACGGCGGAGGCAGGCAGTGCATCCAAGGGTGGCTTCTGCTTCTGGTAGGATCGATGCCACGATGACAGCACGAGCATCTTCACCGAAAAAGTGAATCGCATATGGGCCATATAAACGTCCGTTTTGTGCAGCTCAAATGTGCAGCTCAAACGACTCGTACTT

Full Affymetrix probeset data:

Annotations for 1633930_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime